\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700414800:

Variant ID: vg0700414800 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 414800
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCTCTCATCGTCTATTCGTCTCGCTCCCTCTTCTCTCTCTCTCGTTTCGCTCTCTTCCCTCTCGTCTCGCTCTCTTCTCTCTCCTGCACGCTGCCGGCG[G/A]
TTGGCTGGCAGAGGCGTGCGGCAGCGGTGACCATGCCCTCCCCTCCACCAGATCCGGCGGGAGGGGAGGCAGCGACAAGGAGATGGTGGCGGGGAGGCGA

Reverse complement sequence

TCGCCTCCCCGCCACCATCTCCTTGTCGCTGCCTCCCCTCCCGCCGGATCTGGTGGAGGGGAGGGCATGGTCACCGCTGCCGCACGCCTCTGCCAGCCAA[C/T]
CGCCGGCAGCGTGCAGGAGAGAGAAGAGAGCGAGACGAGAGGGAAGAGAGCGAAACGAGAGAGAGAGAAGAGGGAGCGAGACGAATAGACGATGAGAGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 2.30% 3.91% 0.00% NA
All Indica  2759 89.40% 3.90% 6.71% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 61.50% 14.50% 24.03% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.70% 0.00% 0.33% 0.00% NA
Indica Intermediate  786 92.60% 2.40% 4.96% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700414800 G -> A LOC_Os07g01680.1 upstream_gene_variant ; 1211.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700414800 G -> A LOC_Os07g01690.1 upstream_gene_variant ; 100.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700414800 G -> A LOC_Os07g01700.1 downstream_gene_variant ; 4136.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700414800 G -> A LOC_Os07g01680-LOC_Os07g01690 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700414800 NA 1.94E-09 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0700414800 NA 2.47E-06 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0700414800 NA 1.13E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700414800 NA 9.41E-08 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700414800 1.51E-07 6.52E-11 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700414800 3.43E-07 6.32E-10 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700414800 4.82E-06 NA mr1517_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251