Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0700414800:

Variant ID: vg0700414800 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 414800
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCTCTCATCGTCTATTCGTCTCGCTCCCTCTTCTCTCTCTCTCGTTTCGCTCTCTTCCCTCTCGTCTCGCTCTCTTCTCTCTCCTGCACGCTGCCGGCG[G/A]
TTGGCTGGCAGAGGCGTGCGGCAGCGGTGACCATGCCCTCCCCTCCACCAGATCCGGCGGGAGGGGAGGCAGCGACAAGGAGATGGTGGCGGGGAGGCGA

Reverse complement sequence

TCGCCTCCCCGCCACCATCTCCTTGTCGCTGCCTCCCCTCCCGCCGGATCTGGTGGAGGGGAGGGCATGGTCACCGCTGCCGCACGCCTCTGCCAGCCAA[C/T]
CGCCGGCAGCGTGCAGGAGAGAGAAGAGAGCGAGACGAGAGGGAAGAGAGCGAAACGAGAGAGAGAGAAGAGGGAGCGAGACGAATAGACGATGAGAGCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.80%	2.30%	3.91%	0.00%	NA
All Indica	2759	89.40%	3.90%	6.71%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	61.50%	14.50%	24.03%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.70%	0.00%	0.33%	0.00%	NA
Indica Intermediate	786	92.60%	2.40%	4.96%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0700414800	G -> A	LOC_Os07g01680.1	upstream_gene_variant ; 1211.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700414800	G -> A	LOC_Os07g01690.1	upstream_gene_variant ; 100.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700414800	G -> A	LOC_Os07g01700.1	downstream_gene_variant ; 4136.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700414800	G -> A	LOC_Os07g01680-LOC_Os07g01690	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0700414800	NA	1.94E-09	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0700414800	NA	2.47E-06	Spikelet_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0700414800	NA	1.13E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700414800	NA	9.41E-08	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700414800	1.51E-07	6.52E-11	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700414800	3.43E-07	6.32E-10	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700414800	4.82E-06	NA	mr1517_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251