\
| Variant ID: vg0700414800 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 414800 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGCTCTCATCGTCTATTCGTCTCGCTCCCTCTTCTCTCTCTCTCGTTTCGCTCTCTTCCCTCTCGTCTCGCTCTCTTCTCTCTCCTGCACGCTGCCGGCG[G/A]
TTGGCTGGCAGAGGCGTGCGGCAGCGGTGACCATGCCCTCCCCTCCACCAGATCCGGCGGGAGGGGAGGCAGCGACAAGGAGATGGTGGCGGGGAGGCGA
TCGCCTCCCCGCCACCATCTCCTTGTCGCTGCCTCCCCTCCCGCCGGATCTGGTGGAGGGGAGGGCATGGTCACCGCTGCCGCACGCCTCTGCCAGCCAA[C/T]
CGCCGGCAGCGTGCAGGAGAGAGAAGAGAGCGAGACGAGAGGGAAGAGAGCGAAACGAGAGAGAGAGAAGAGGGAGCGAGACGAATAGACGATGAGAGCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 2.30% | 3.91% | 0.00% | NA |
| All Indica | 2759 | 89.40% | 3.90% | 6.71% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 61.50% | 14.50% | 24.03% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.00% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 92.60% | 2.40% | 4.96% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700414800 | G -> A | LOC_Os07g01680.1 | upstream_gene_variant ; 1211.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700414800 | G -> A | LOC_Os07g01690.1 | upstream_gene_variant ; 100.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700414800 | G -> A | LOC_Os07g01700.1 | downstream_gene_variant ; 4136.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700414800 | G -> A | LOC_Os07g01680-LOC_Os07g01690 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700414800 | NA | 1.94E-09 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0700414800 | NA | 2.47E-06 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0700414800 | NA | 1.13E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700414800 | NA | 9.41E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700414800 | 1.51E-07 | 6.52E-11 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700414800 | 3.43E-07 | 6.32E-10 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700414800 | 4.82E-06 | NA | mr1517_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |