\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700362980:

Variant ID: vg0700362980 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 362980
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAATGGGAATCGTAACTAGAATCAGCCTATGTGGCAGATGGATGACCTGAGTGGTCAGAAACGAATCTGTGTGATTCGGGATGTCTGTAGGCATCATA[A/G]
ACTAGGCTTCCCGAGTGGAAGCGGATTGTTGTGCTGCTGGGCAGTTGGACTCTGGGAGTCTGTAAAAATGAAAAAGGCTCTGGGAGCCTCCTAATCAAGT

Reverse complement sequence

ACTTGATTAGGAGGCTCCCAGAGCCTTTTTCATTTTTACAGACTCCCAGAGTCCAACTGCCCAGCAGCACAACAATCCGCTTCCACTCGGGAAGCCTAGT[T/C]
TATGATGCCTACAGACATCCCGAATCACACAGATTCGTTTCTGACCACTCAGGTCATCCATCTGCCACATAGGCTGATTCTAGTTACGATTCCCATTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.20% 40.50% 0.19% 7.15% NA
All Indica  2759 83.30% 13.80% 0.07% 2.83% NA
All Japonica  1512 7.90% 91.90% 0.07% 0.07% NA
Aus  269 7.80% 0.70% 0.74% 90.71% NA
Indica I  595 97.60% 1.80% 0.17% 0.34% NA
Indica II  465 43.40% 56.10% 0.00% 0.43% NA
Indica III  913 95.60% 0.40% 0.00% 3.94% NA
Indica Intermediate  786 81.70% 13.40% 0.13% 4.83% NA
Temperate Japonica  767 3.80% 96.10% 0.00% 0.13% NA
Tropical Japonica  504 16.70% 83.10% 0.20% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 89.60% 0.00% 5.21% NA
Intermediate  90 24.40% 60.00% 4.44% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700362980 A -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700362980 A -> G LOC_Os07g01570.1 upstream_gene_variant ; 4059.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700362980 A -> G LOC_Os07g01580.1 downstream_gene_variant ; 1332.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700362980 A -> G LOC_Os07g01590.1 downstream_gene_variant ; 4536.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700362980 A -> G LOC_Os07g01570-LOC_Os07g01580 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700362980 NA 5.73E-10 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700362980 NA 1.55E-07 mr1216 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700362980 NA 3.59E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700362980 2.89E-07 2.71E-06 mr1668 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700362980 NA 2.43E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700362980 NA 5.73E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700362980 NA 1.22E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700362980 NA 6.32E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700362980 NA 2.32E-07 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700362980 NA 1.51E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700362980 NA 1.18E-10 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700362980 NA 2.12E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700362980 NA 1.36E-12 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700362980 NA 1.63E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700362980 NA 2.30E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700362980 NA 7.37E-09 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251