\
| Variant ID: vg0700362980 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 362980 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 104. )
TGGAATGGGAATCGTAACTAGAATCAGCCTATGTGGCAGATGGATGACCTGAGTGGTCAGAAACGAATCTGTGTGATTCGGGATGTCTGTAGGCATCATA[A/G]
ACTAGGCTTCCCGAGTGGAAGCGGATTGTTGTGCTGCTGGGCAGTTGGACTCTGGGAGTCTGTAAAAATGAAAAAGGCTCTGGGAGCCTCCTAATCAAGT
ACTTGATTAGGAGGCTCCCAGAGCCTTTTTCATTTTTACAGACTCCCAGAGTCCAACTGCCCAGCAGCACAACAATCCGCTTCCACTCGGGAAGCCTAGT[T/C]
TATGATGCCTACAGACATCCCGAATCACACAGATTCGTTTCTGACCACTCAGGTCATCCATCTGCCACATAGGCTGATTCTAGTTACGATTCCCATTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.20% | 40.50% | 0.19% | 7.15% | NA |
| All Indica | 2759 | 83.30% | 13.80% | 0.07% | 2.83% | NA |
| All Japonica | 1512 | 7.90% | 91.90% | 0.07% | 0.07% | NA |
| Aus | 269 | 7.80% | 0.70% | 0.74% | 90.71% | NA |
| Indica I | 595 | 97.60% | 1.80% | 0.17% | 0.34% | NA |
| Indica II | 465 | 43.40% | 56.10% | 0.00% | 0.43% | NA |
| Indica III | 913 | 95.60% | 0.40% | 0.00% | 3.94% | NA |
| Indica Intermediate | 786 | 81.70% | 13.40% | 0.13% | 4.83% | NA |
| Temperate Japonica | 767 | 3.80% | 96.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 16.70% | 83.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 89.60% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 24.40% | 60.00% | 4.44% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700362980 | A -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700362980 | A -> G | LOC_Os07g01570.1 | upstream_gene_variant ; 4059.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700362980 | A -> G | LOC_Os07g01580.1 | downstream_gene_variant ; 1332.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700362980 | A -> G | LOC_Os07g01590.1 | downstream_gene_variant ; 4536.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700362980 | A -> G | LOC_Os07g01570-LOC_Os07g01580 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700362980 | NA | 5.73E-10 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700362980 | NA | 1.55E-07 | mr1216 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700362980 | NA | 3.59E-06 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700362980 | 2.89E-07 | 2.71E-06 | mr1668 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700362980 | NA | 2.43E-06 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700362980 | NA | 5.73E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700362980 | NA | 1.22E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700362980 | NA | 6.32E-06 | mr1042_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700362980 | NA | 2.32E-07 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700362980 | NA | 1.51E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700362980 | NA | 1.18E-10 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700362980 | NA | 2.12E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700362980 | NA | 1.36E-12 | mr1383_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700362980 | NA | 1.63E-06 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700362980 | NA | 2.30E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700362980 | NA | 7.37E-09 | mr1889_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |