\
| Variant ID: vg0700359527 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 359527 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACACGGAAACCCATAACCACACTTAAAATGGGACGAAGGGAGTAGTTTGACAGATACATCAAATTCTGCAGATAAGTTGAGAACAAGGCTAGTTTCACTT[T/G]
AACTGCAGACTGCCAAGTTGATATTAATATTATACTGTGCCACACCTGATCTAATTAAGTTTCCCATTGTTCTCGAGGTCCTGCTGATCATCATCATCCA
TGGATGATGATGATCAGCAGGACCTCGAGAACAATGGGAAACTTAATTAGATCAGGTGTGGCACAGTATAATATTAATATCAACTTGGCAGTCTGCAGTT[A/C]
AAGTGAAACTAGCCTTGTTCTCAACTTATCTGCAGAATTTGATGTATCTGTCAAACTACTCCCTTCGTCCCATTTTAAGTGTGGTTATGGGTTTCCGTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.90% | 21.00% | 3.15% | 0.00% | NA |
| All Indica | 2759 | 95.90% | 3.30% | 0.80% | 0.00% | NA |
| All Japonica | 1512 | 51.30% | 41.00% | 7.74% | 0.00% | NA |
| Aus | 269 | 6.30% | 93.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 94.20% | 2.20% | 3.66% | 0.00% | NA |
| Indica III | 913 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.20% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 17.30% | 73.00% | 9.65% | 0.00% | NA |
| Tropical Japonica | 504 | 92.70% | 3.40% | 3.97% | 0.00% | NA |
| Japonica Intermediate | 241 | 72.60% | 17.80% | 9.54% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 6.20% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 25.60% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700359527 | T -> G | LOC_Os07g01570.1 | upstream_gene_variant ; 606.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700359527 | T -> G | LOC_Os07g01580.1 | downstream_gene_variant ; 4785.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700359527 | T -> G | LOC_Os07g01570-LOC_Os07g01580 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700359527 | 4.27E-06 | 4.56E-22 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700359527 | NA | 8.41E-07 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700359527 | 3.38E-11 | 2.14E-40 | mr1310 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700359527 | 2.11E-07 | 5.30E-12 | mr1310 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700359527 | 3.55E-11 | 9.93E-44 | mr1926 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700359527 | 2.29E-06 | 1.79E-11 | mr1926 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700359527 | 3.28E-07 | 1.53E-13 | mr1959 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700359527 | 1.55E-06 | 2.18E-08 | mr1959 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700359527 | NA | 4.15E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700359527 | 1.93E-08 | 8.89E-36 | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700359527 | NA | 2.70E-11 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700359527 | 2.23E-06 | NA | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700359527 | 2.68E-06 | 1.18E-17 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700359527 | NA | 2.12E-09 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |