RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0700359527:

Variant ID: vg0700359527 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 359527
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACACGGAAACCCATAACCACACTTAAAATGGGACGAAGGGAGTAGTTTGACAGATACATCAAATTCTGCAGATAAGTTGAGAACAAGGCTAGTTTCACTT[T/G]
AACTGCAGACTGCCAAGTTGATATTAATATTATACTGTGCCACACCTGATCTAATTAAGTTTCCCATTGTTCTCGAGGTCCTGCTGATCATCATCATCCA

Reverse complement sequence

TGGATGATGATGATCAGCAGGACCTCGAGAACAATGGGAAACTTAATTAGATCAGGTGTGGCACAGTATAATATTAATATCAACTTGGCAGTCTGCAGTT[A/C]
AAGTGAAACTAGCCTTGTTCTCAACTTATCTGCAGAATTTGATGTATCTGTCAAACTACTCCCTTCGTCCCATTTTAAGTGTGGTTATGGGTTTCCGTGT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.90%	21.00%	3.15%	0.00%	NA
All Indica	2759	95.90%	3.30%	0.80%	0.00%	NA
All Japonica	1512	51.30%	41.00%	7.74%	0.00%	NA
Aus	269	6.30%	93.70%	0.00%	0.00%	NA
Indica I	595	99.30%	0.30%	0.34%	0.00%	NA
Indica II	465	94.20%	2.20%	3.66%	0.00%	NA
Indica III	913	95.90%	4.10%	0.00%	0.00%	NA
Indica Intermediate	786	94.40%	5.20%	0.38%	0.00%	NA
Temperate Japonica	767	17.30%	73.00%	9.65%	0.00%	NA
Tropical Japonica	504	92.70%	3.40%	3.97%	0.00%	NA
Japonica Intermediate	241	72.60%	17.80%	9.54%	0.00%	NA
VI/Aromatic	96	89.60%	6.20%	4.17%	0.00%	NA
Intermediate	90	67.80%	25.60%	6.67%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0700359527	T -> G	LOC_Os07g01570.1	upstream_gene_variant ; 606.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700359527	T -> G	LOC_Os07g01580.1	downstream_gene_variant ; 4785.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700359527	T -> G	LOC_Os07g01570-LOC_Os07g01580	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0700359527	4.27E-06	4.56E-22	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700359527	NA	8.41E-07	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700359527	3.38E-11	2.14E-40	mr1310	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700359527	2.11E-07	5.30E-12	mr1310	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700359527	3.55E-11	9.93E-44	mr1926	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700359527	2.29E-06	1.79E-11	mr1926	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700359527	3.28E-07	1.53E-13	mr1959	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700359527	1.55E-06	2.18E-08	mr1959	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700359527	NA	4.15E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700359527	1.93E-08	8.89E-36	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 14 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0700359527:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact