Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0700333296:

Variant ID: vg0700333296 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 333296
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTAGAAGTACGTAGGAGTACACAGACACAAATTAAATACAACAAGAAAACTCGATGTGTACCTTACATTCATTATATTAGGAAGAAAAATGATGGACG[A/G]
TATATATGGCATTGCGAGAGTAGCATGCGTGTGCAGCAAAACATTAAATTACGGAATATATGTATAAGTATAGTGTTTGGATGGATGAGAGTGGATCTAG

Reverse complement sequence

CTAGATCCACTCTCATCCATCCAAACACTATACTTATACATATATTCCGTAATTTAATGTTTTGCTGCACACGCATGCTACTCTCGCAATGCCATATATA[T/C]
CGTCCATCATTTTTCTTCCTAATATAATGAATGTAAGGTACACATCGAGTTTTCTTGTTGTATTTAATTTGTGTCTGTGTACTCCTACGTACTTCTACAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.90%	6.60%	1.54%	0.00%	NA
All Indica	2759	88.00%	10.30%	1.63%	0.00%	NA
All Japonica	1512	97.10%	1.40%	1.52%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	48.80%	43.70%	7.53%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	88.40%	10.30%	1.27%	0.00%	NA
Temperate Japonica	767	98.40%	0.30%	1.30%	0.00%	NA
Tropical Japonica	504	94.80%	3.60%	1.59%	0.00%	NA
Japonica Intermediate	241	97.50%	0.40%	2.07%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	5.60%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0700333296	A -> G	LOC_Os07g01530.1	3_prime_UTR_variant ; 97.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700333296	A -> G	LOC_Os07g01520.1	downstream_gene_variant ; 3995.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700333296	A -> G	LOC_Os07g01540.1	downstream_gene_variant ; 1927.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0700333296	NA	5.78E-09	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700333296	NA	6.17E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700333296	NA	1.26E-09	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700333296	NA	2.43E-06	mr1042_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700333296	NA	3.37E-07	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700333296	NA	6.31E-10	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700333296	NA	1.17E-11	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700333296	3.03E-06	NA	mr1383_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700333296	3.14E-06	1.45E-14	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700333296	NA	8.74E-07	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700333296	NA	2.35E-06	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251