\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700260893:

Variant ID: vg0700260893 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 260893
Reference Allele: CAlternative Allele: T,CATAT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTTGGAAGCGAGCGCGTGGAAAATGAGAGAGTAAAAGTTTGAAAAGGTAAAGAAAGTCCCATTTTATATATATAGTTGTCATCAACCTGTTGTACATA[C/T,CATAT]
ATTGTGTATGAGGTCATGTCGTTGTATGCATGGTAAAAGTGGGACTGTGAAGGAGAGAAGCTAGTGGTCGATCCTATTTATCTCAATTTCTAAATATAAG

Reverse complement sequence

CTTATATTTAGAAATTGAGATAAATAGGATCGACCACTAGCTTCTCTCCTTCACAGTCCCACTTTTACCATGCATACAACGACATGACCTCATACACAAT[G/A,ATATG]
TATGTACAACAGGTTGATGACAACTATATATATAAAATGGGACTTTCTTTACCTTTTCAAACTTTTACTCTCTCATTTTCCACGCGCTCGCTTCCAAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 40.00% 1.16% 0.68% CATAT: 0.02%
All Indica  2759 39.10% 57.70% 1.92% 1.16% CATAT: 0.04%
All Japonica  1512 97.90% 2.00% 0.07% 0.00% NA
Aus  269 13.40% 86.60% 0.00% 0.00% NA
Indica I  595 56.00% 41.20% 2.18% 0.67% NA
Indica II  465 53.50% 43.20% 1.29% 1.94% NA
Indica III  913 27.50% 70.40% 1.42% 0.55% CATAT: 0.11%
Indica Intermediate  786 31.40% 64.10% 2.67% 1.78% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 95.20% 4.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700260893 C -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700260893 C -> CATAT LOC_Os07g01420.1 upstream_gene_variant ; 3631.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700260893 C -> CATAT LOC_Os07g01410.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700260893 C -> T LOC_Os07g01420.1 upstream_gene_variant ; 3632.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700260893 C -> T LOC_Os07g01410.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700260893 1.88E-06 NA mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893 3.54E-08 8.85E-11 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893 NA 1.14E-07 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893 NA 8.41E-08 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893 NA 1.61E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893 2.44E-07 3.11E-10 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893 NA 3.92E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893 NA 8.37E-09 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893 5.82E-06 2.14E-08 mr1168_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893 NA 7.02E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251