Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700260893:

Variant ID: vg0700260893 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 260893
Reference Allele: C	Alternative Allele: T,CATAT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTTGGAAGCGAGCGCGTGGAAAATGAGAGAGTAAAAGTTTGAAAAGGTAAAGAAAGTCCCATTTTATATATATAGTTGTCATCAACCTGTTGTACATA[C/T,CATAT]
ATTGTGTATGAGGTCATGTCGTTGTATGCATGGTAAAAGTGGGACTGTGAAGGAGAGAAGCTAGTGGTCGATCCTATTTATCTCAATTTCTAAATATAAG

Reverse complement sequence

CTTATATTTAGAAATTGAGATAAATAGGATCGACCACTAGCTTCTCTCCTTCACAGTCCCACTTTTACCATGCATACAACGACATGACCTCATACACAAT[G/A,ATATG]
TATGTACAACAGGTTGATGACAACTATATATATAAAATGGGACTTTCTTTACCTTTTCAAACTTTTACTCTCTCATTTTCCACGCGCTCGCTTCCAAAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	40.00%	1.16%	0.68%	CATAT: 0.02%
All Indica	2759	39.10%	57.70%	1.92%	1.16%	CATAT: 0.04%
All Japonica	1512	97.90%	2.00%	0.07%	0.00%	NA
Aus	269	13.40%	86.60%	0.00%	0.00%	NA
Indica I	595	56.00%	41.20%	2.18%	0.67%	NA
Indica II	465	53.50%	43.20%	1.29%	1.94%	NA
Indica III	913	27.50%	70.40%	1.42%	0.55%	CATAT: 0.11%
Indica Intermediate	786	31.40%	64.10%	2.67%	1.78%	NA
Temperate Japonica	767	99.50%	0.40%	0.13%	0.00%	NA
Tropical Japonica	504	95.20%	4.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	68.90%	30.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0700260893	C -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700260893	C -> CATAT	LOC_Os07g01420.1	upstream_gene_variant ; 3631.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700260893	C -> CATAT	LOC_Os07g01410.1	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700260893	C -> T	LOC_Os07g01420.1	upstream_gene_variant ; 3632.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700260893	C -> T	LOC_Os07g01410.1	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0700260893	1.88E-06	NA	mr1158	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893	3.54E-08	8.85E-11	mr1158	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893	NA	1.14E-07	mr1168	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893	NA	8.41E-08	mr1316	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893	NA	1.61E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893	2.44E-07	3.11E-10	mr1383	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893	NA	3.92E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893	NA	8.37E-09	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893	5.82E-06	2.14E-08	mr1168_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700260893	NA	7.02E-07	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251