\
| Variant ID: vg0700260893 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 260893 |
| Reference Allele: C | Alternative Allele: T,CATAT |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 119. )
GTTTTGGAAGCGAGCGCGTGGAAAATGAGAGAGTAAAAGTTTGAAAAGGTAAAGAAAGTCCCATTTTATATATATAGTTGTCATCAACCTGTTGTACATA[C/T,CATAT]
ATTGTGTATGAGGTCATGTCGTTGTATGCATGGTAAAAGTGGGACTGTGAAGGAGAGAAGCTAGTGGTCGATCCTATTTATCTCAATTTCTAAATATAAG
CTTATATTTAGAAATTGAGATAAATAGGATCGACCACTAGCTTCTCTCCTTCACAGTCCCACTTTTACCATGCATACAACGACATGACCTCATACACAAT[G/A,ATATG]
TATGTACAACAGGTTGATGACAACTATATATATAAAATGGGACTTTCTTTACCTTTTCAAACTTTTACTCTCTCATTTTCCACGCGCTCGCTTCCAAAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 40.00% | 1.16% | 0.68% | CATAT: 0.02% |
| All Indica | 2759 | 39.10% | 57.70% | 1.92% | 1.16% | CATAT: 0.04% |
| All Japonica | 1512 | 97.90% | 2.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 13.40% | 86.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 56.00% | 41.20% | 2.18% | 0.67% | NA |
| Indica II | 465 | 53.50% | 43.20% | 1.29% | 1.94% | NA |
| Indica III | 913 | 27.50% | 70.40% | 1.42% | 0.55% | CATAT: 0.11% |
| Indica Intermediate | 786 | 31.40% | 64.10% | 2.67% | 1.78% | NA |
| Temperate Japonica | 767 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 30.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700260893 | C -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700260893 | C -> CATAT | LOC_Os07g01420.1 | upstream_gene_variant ; 3631.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700260893 | C -> CATAT | LOC_Os07g01410.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700260893 | C -> T | LOC_Os07g01420.1 | upstream_gene_variant ; 3632.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700260893 | C -> T | LOC_Os07g01410.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700260893 | 1.88E-06 | NA | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700260893 | 3.54E-08 | 8.85E-11 | mr1158 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700260893 | NA | 1.14E-07 | mr1168 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700260893 | NA | 8.41E-08 | mr1316 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700260893 | NA | 1.61E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700260893 | 2.44E-07 | 3.11E-10 | mr1383 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700260893 | NA | 3.92E-13 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700260893 | NA | 8.37E-09 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700260893 | 5.82E-06 | 2.14E-08 | mr1168_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700260893 | NA | 7.02E-07 | mr1383_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |