\
| Variant ID: vg0700250116 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 250116 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 117. )
AGTAGTCATCTGTGACGGGCTATAGTTTAGGCCCGATTGAGATGTGTATCATCTGTGACGGGCTCTAGTTTAGGCCCGATAAAGGTTAGTAGTCATCTGT[G/A]
ACGGGCGCTAGTTGTGGCCCGATAGAGATAGGTCATCTGTAACGGGCTATAGTTTGACTGGTCGTCTGGGTCAAAGCTATCTGTGACGAGCTTTACTTAG
CTAAGTAAAGCTCGTCACAGATAGCTTTGACCCAGACGACCAGTCAAACTATAGCCCGTTACAGATGACCTATCTCTATCGGGCCACAACTAGCGCCCGT[C/T]
ACAGATGACTACTAACCTTTATCGGGCCTAAACTAGAGCCCGTCACAGATGATACACATCTCAATCGGGCCTAAACTATAGCCCGTCACAGATGACTACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.40% | 46.50% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 31.30% | 68.50% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 13.00% | 87.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 56.60% | 43.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 51.40% | 48.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 8.40% | 91.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 26.80% | 72.80% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 35.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700250116 | G -> A | LOC_Os07g01400.1 | upstream_gene_variant ; 2702.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700250116 | G -> A | LOC_Os07g01390.1 | downstream_gene_variant ; 1494.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700250116 | G -> A | LOC_Os07g01390-LOC_Os07g01400 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700250116 | NA | 2.87E-07 | mr1158 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700250116 | NA | 3.07E-06 | mr1168 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700250116 | 2.52E-06 | 3.87E-09 | mr1316 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700250116 | NA | 8.63E-07 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700250116 | 6.89E-06 | NA | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700250116 | 5.22E-07 | 1.28E-09 | mr1383 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700250116 | NA | 8.32E-13 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700250116 | NA | 1.60E-06 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |