\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700250116:

Variant ID: vg0700250116 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 250116
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


AGTAGTCATCTGTGACGGGCTATAGTTTAGGCCCGATTGAGATGTGTATCATCTGTGACGGGCTCTAGTTTAGGCCCGATAAAGGTTAGTAGTCATCTGT[G/A]
ACGGGCGCTAGTTGTGGCCCGATAGAGATAGGTCATCTGTAACGGGCTATAGTTTGACTGGTCGTCTGGGTCAAAGCTATCTGTGACGAGCTTTACTTAG

Reverse complement sequence

CTAAGTAAAGCTCGTCACAGATAGCTTTGACCCAGACGACCAGTCAAACTATAGCCCGTTACAGATGACCTATCTCTATCGGGCCACAACTAGCGCCCGT[C/T]
ACAGATGACTACTAACCTTTATCGGGCCTAAACTAGAGCCCGTCACAGATGATACACATCTCAATCGGGCCTAAACTATAGCCCGTCACAGATGACTACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.40% 46.50% 0.11% 0.00% NA
All Indica  2759 31.30% 68.50% 0.18% 0.00% NA
All Japonica  1512 97.90% 2.10% 0.00% 0.00% NA
Aus  269 13.00% 87.00% 0.00% 0.00% NA
Indica I  595 56.60% 43.20% 0.17% 0.00% NA
Indica II  465 51.40% 48.60% 0.00% 0.00% NA
Indica III  913 8.40% 91.50% 0.11% 0.00% NA
Indica Intermediate  786 26.80% 72.80% 0.38% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 94.80% 5.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700250116 G -> A LOC_Os07g01400.1 upstream_gene_variant ; 2702.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700250116 G -> A LOC_Os07g01390.1 downstream_gene_variant ; 1494.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700250116 G -> A LOC_Os07g01390-LOC_Os07g01400 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700250116 NA 2.87E-07 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700250116 NA 3.07E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700250116 2.52E-06 3.87E-09 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700250116 NA 8.63E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700250116 6.89E-06 NA mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700250116 5.22E-07 1.28E-09 mr1383 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700250116 NA 8.32E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700250116 NA 1.60E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251