\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700233324:

Variant ID: vg0700233324 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 233324
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


CCCGGTCGGACCGGACACATAAAATAACAGTGAATCCGATCATCACCTGAAAATTGATTATCTCCAGAACCACTTCGACGATAATCTCCAAATATCAAAA[C/T]
CAATAATCACAGATGCCAATTGTTCATCACAGAATAAGAATCAAAACACACATTGATCTTACAAATTGTAATATATATGATTGTTACTAGCTGGCCATGC

Reverse complement sequence

GCATGGCCAGCTAGTAACAATCATATATATTACAATTTGTAAGATCAATGTGTGTTTTGATTCTTATTCTGTGATGAACAATTGGCATCTGTGATTATTG[G/A]
TTTTGATATTTGGAGATTATCGTCGAAGTGGTTCTGGAGATAATCAATTTTCAGGTGATGATCGGATTCACTGTTATTTTATGTGTCCGGTCCGACCGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 42.10% 0.36% 0.00% NA
All Indica  2759 38.60% 60.90% 0.43% 0.00% NA
All Japonica  1512 97.90% 1.90% 0.20% 0.00% NA
Aus  269 11.20% 88.80% 0.00% 0.00% NA
Indica I  595 55.80% 43.70% 0.50% 0.00% NA
Indica II  465 53.50% 46.00% 0.43% 0.00% NA
Indica III  913 26.90% 72.80% 0.22% 0.00% NA
Indica Intermediate  786 30.40% 69.00% 0.64% 0.00% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 94.80% 4.80% 0.40% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 9.40% 1.04% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700233324 C -> T LOC_Os07g01360.1 upstream_gene_variant ; 489.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700233324 C -> T LOC_Os07g01370.1 upstream_gene_variant ; 2579.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700233324 C -> T LOC_Os07g01360-LOC_Os07g01370 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700233324 1.18E-06 NA mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324 9.03E-08 8.18E-11 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324 4.53E-06 8.93E-09 mr1168 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324 2.74E-06 5.21E-09 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324 NA 2.04E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324 2.89E-06 NA mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324 2.22E-08 3.28E-11 mr1383 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324 NA 8.93E-06 mr1723 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324 NA 4.83E-09 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324 NA 1.34E-06 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251