Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0700233324:

Variant ID: vg0700233324 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 233324
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

CCCGGTCGGACCGGACACATAAAATAACAGTGAATCCGATCATCACCTGAAAATTGATTATCTCCAGAACCACTTCGACGATAATCTCCAAATATCAAAA[C/T]
CAATAATCACAGATGCCAATTGTTCATCACAGAATAAGAATCAAAACACACATTGATCTTACAAATTGTAATATATATGATTGTTACTAGCTGGCCATGC

Reverse complement sequence

GCATGGCCAGCTAGTAACAATCATATATATTACAATTTGTAAGATCAATGTGTGTTTTGATTCTTATTCTGTGATGAACAATTGGCATCTGTGATTATTG[G/A]
TTTTGATATTTGGAGATTATCGTCGAAGTGGTTCTGGAGATAATCAATTTTCAGGTGATGATCGGATTCACTGTTATTTTATGTGTCCGGTCCGACCGGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.60%	42.10%	0.36%	0.00%	NA
All Indica	2759	38.60%	60.90%	0.43%	0.00%	NA
All Japonica	1512	97.90%	1.90%	0.20%	0.00%	NA
Aus	269	11.20%	88.80%	0.00%	0.00%	NA
Indica I	595	55.80%	43.70%	0.50%	0.00%	NA
Indica II	465	53.50%	46.00%	0.43%	0.00%	NA
Indica III	913	26.90%	72.80%	0.22%	0.00%	NA
Indica Intermediate	786	30.40%	69.00%	0.64%	0.00%	NA
Temperate Japonica	767	99.50%	0.40%	0.13%	0.00%	NA
Tropical Japonica	504	94.80%	4.80%	0.40%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	9.40%	1.04%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0700233324	C -> T	LOC_Os07g01360.1	upstream_gene_variant ; 489.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700233324	C -> T	LOC_Os07g01370.1	upstream_gene_variant ; 2579.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700233324	C -> T	LOC_Os07g01360-LOC_Os07g01370	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0700233324	1.18E-06	NA	mr1158	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324	9.03E-08	8.18E-11	mr1158	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324	4.53E-06	8.93E-09	mr1168	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324	2.74E-06	5.21E-09	mr1316	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324	NA	2.04E-07	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324	2.89E-06	NA	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324	2.22E-08	3.28E-11	mr1383	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324	NA	8.93E-06	mr1723	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324	NA	4.83E-09	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700233324	NA	1.34E-06	mr1168_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251