| Variant ID: vg0700233324 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 233324 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 268. )
CCCGGTCGGACCGGACACATAAAATAACAGTGAATCCGATCATCACCTGAAAATTGATTATCTCCAGAACCACTTCGACGATAATCTCCAAATATCAAAA[C/T]
CAATAATCACAGATGCCAATTGTTCATCACAGAATAAGAATCAAAACACACATTGATCTTACAAATTGTAATATATATGATTGTTACTAGCTGGCCATGC
GCATGGCCAGCTAGTAACAATCATATATATTACAATTTGTAAGATCAATGTGTGTTTTGATTCTTATTCTGTGATGAACAATTGGCATCTGTGATTATTG[G/A]
TTTTGATATTTGGAGATTATCGTCGAAGTGGTTCTGGAGATAATCAATTTTCAGGTGATGATCGGATTCACTGTTATTTTATGTGTCCGGTCCGACCGGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.60% | 42.10% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 38.60% | 60.90% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 97.90% | 1.90% | 0.20% | 0.00% | NA |
| Aus | 269 | 11.20% | 88.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 55.80% | 43.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 53.50% | 46.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 26.90% | 72.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 30.40% | 69.00% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 4.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 9.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 33.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700233324 | C -> T | LOC_Os07g01360.1 | upstream_gene_variant ; 489.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700233324 | C -> T | LOC_Os07g01370.1 | upstream_gene_variant ; 2579.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700233324 | C -> T | LOC_Os07g01360-LOC_Os07g01370 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700233324 | 1.18E-06 | NA | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700233324 | 9.03E-08 | 8.18E-11 | mr1158 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700233324 | 4.53E-06 | 8.93E-09 | mr1168 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700233324 | 2.74E-06 | 5.21E-09 | mr1316 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700233324 | NA | 2.04E-07 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700233324 | 2.89E-06 | NA | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700233324 | 2.22E-08 | 3.28E-11 | mr1383 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700233324 | NA | 8.93E-06 | mr1723 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700233324 | NA | 4.83E-09 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700233324 | NA | 1.34E-06 | mr1168_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |