\
| Variant ID: vg0700219361 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 219361 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, T: 0.36, others allele: 0.00, population size: 245. )
ACCCGCCCTACTCCTACTATATATATCAAATCACCACTGCTATAATGCATTATACTCGATCCACTATGCATTTTTCATCGCCACAATATGCATGTACCTA[G/T]
CCAATAATTAATTAAGCTGCACTTTGCTTACTTATTGCTAGCTTGCTACTGCATCGATCTATATGCATGTACACACATTTCATTGCCTTAGCAGTGTATG
CATACACTGCTAAGGCAATGAAATGTGTGTACATGCATATAGATCGATGCAGTAGCAAGCTAGCAATAAGTAAGCAAAGTGCAGCTTAATTAATTATTGG[C/A]
TAGGTACATGCATATTGTGGCGATGAAAAATGCATAGTGGATCGAGTATAATGCATTATAGCAGTGGTGATTTGATATATATAGTAGGAGTAGGGCGGGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.40% | 46.10% | 0.17% | 0.30% | NA |
| All Indica | 2759 | 79.20% | 20.30% | 0.14% | 0.36% | NA |
| All Japonica | 1512 | 2.00% | 97.70% | 0.13% | 0.20% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 46.50% | 52.00% | 0.65% | 0.86% | NA |
| Indica III | 913 | 80.80% | 19.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 82.70% | 16.40% | 0.13% | 0.76% | NA |
| Temperate Japonica | 767 | 0.40% | 99.50% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 4.80% | 94.60% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 86.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 35.60% | 62.20% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700219361 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700219361 | G -> T | LOC_Os07g01340.1 | 3_prime_UTR_variant ; 122.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700219361 | NA | 1.33E-08 | mr1050 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | NA | 1.19E-14 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | NA | 5.21E-22 | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | 4.06E-06 | NA | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | 4.08E-07 | 1.40E-08 | mr1158 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | NA | 2.41E-06 | mr1168 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | 1.90E-06 | 7.12E-09 | mr1383 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | NA | 1.40E-25 | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | NA | 3.10E-15 | mr1535 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | NA | 1.75E-07 | mr1680 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | NA | 2.56E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | NA | 5.40E-09 | mr1050_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | NA | 4.94E-13 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | 4.01E-07 | NA | mr1168_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | 3.48E-08 | 4.08E-08 | mr1168_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | 3.19E-07 | NA | mr1383_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | 3.98E-09 | 1.19E-16 | mr1383_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700219361 | NA | 4.91E-23 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |