\
| Variant ID: vg0700217039 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 217039 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 254. )
CAGACAAAAGAATCGCCGTTGATTCTGGGAGCGTTCGCCTACAACGATCGTCTTGTTCTTGTGACGTTATGCCTATGAAAACACACTTGGGATATTCACA[T/C]
ATTCTGGTAGTGATTATTGTATATTCCTACATTTTCTTTAGAAAATAATAGAAGTTTTTATTTAACTCAGCTAATTATATCAAGATGATACAAAACCACT
AGTGGTTTTGTATCATCTTGATATAATTAGCTGAGTTAAATAAAAACTTCTATTATTTTCTAAAGAAAATGTAGGAATATACAATAATCACTACCAGAAT[A/G]
TGTGAATATCCCAAGTGTGTTTTCATAGGCATAACGTCACAAGAACAAGACGATCGTTGTAGGCGAACGCTCCCAGAATCAACGGCGATTCTTTTGTCTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.80% | 35.90% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 40.30% | 59.40% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 97.90% | 2.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 56.00% | 44.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 53.80% | 45.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 29.50% | 70.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 33.10% | 66.20% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 4.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 26.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700217039 | T -> C | LOC_Os07g01340.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700217039 | 3.00E-08 | NA | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700217039 | 2.00E-08 | 4.14E-11 | mr1158 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700217039 | NA | 6.01E-08 | mr1168 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700217039 | NA | 2.15E-13 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700217039 | 7.84E-06 | 1.06E-08 | mr1316 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700217039 | NA | 3.14E-07 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700217039 | 2.16E-08 | NA | mr1383 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700217039 | 5.09E-08 | 6.47E-11 | mr1383 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700217039 | NA | 5.16E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700217039 | NA | 2.01E-06 | mr1941 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700217039 | NA | 9.07E-08 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700217039 | NA | 1.24E-08 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700217039 | 3.64E-06 | NA | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700217039 | NA | 5.49E-08 | mr1168_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700217039 | NA | 8.88E-06 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700217039 | NA | 5.64E-08 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |