\
| Variant ID: vg0700211553 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 211553 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTTATTTTAAGGATTGCTATGATTCATATTTGTTACCGTGGGTACCAGCACTATGTCCTGGGACTGGTATCGAGATTGCGGTTTCTTAGGAAGCGGTTCG[T/C]
GCCGTTTTCCCCTACGACACGCTCCTGTCAGGTGCCGTTGTACGGCGGTACCAGATTGGGGTGTGACAGTTACTCTCGAATCGATGTAAATCGGTCTGAC
GTCAGACCGATTTACATCGATTCGAGAGTAACTGTCACACCCCAATCTGGTACCGCCGTACAACGGCACCTGACAGGAGCGTGTCGTAGGGGAAAACGGC[A/G]
CGAACCGCTTCCTAAGAAACCGCAATCTCGATACCAGTCCCAGGACATAGTGCTGGTACCCACGGTAACAAATATGAATCATAGCAATCCTTAAAATAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 11.30% | 0.90% | 12.61% | 75.18% | NA |
| All Indica | 2759 | 1.90% | 1.60% | 16.31% | 80.21% | NA |
| All Japonica | 1512 | 20.20% | 0.00% | 1.32% | 78.44% | NA |
| Aus | 269 | 59.90% | 0.40% | 39.03% | 0.74% | NA |
| Indica I | 595 | 0.30% | 1.50% | 16.64% | 81.51% | NA |
| Indica II | 465 | 1.10% | 0.40% | 4.30% | 94.19% | NA |
| Indica III | 913 | 2.60% | 2.10% | 24.75% | 70.54% | NA |
| Indica Intermediate | 786 | 2.80% | 1.70% | 13.36% | 82.19% | NA |
| Temperate Japonica | 767 | 22.70% | 0.00% | 1.04% | 76.27% | NA |
| Tropical Japonica | 504 | 23.60% | 0.00% | 1.39% | 75.00% | NA |
| Japonica Intermediate | 241 | 5.40% | 0.00% | 2.07% | 92.53% | NA |
| VI/Aromatic | 96 | 2.10% | 0.00% | 7.29% | 90.62% | NA |
| Intermediate | 90 | 12.20% | 0.00% | 15.56% | 72.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700211553 | T -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700211553 | T -> C | LOC_Os07g01330.1 | upstream_gene_variant ; 2763.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700211553 | T -> C | LOC_Os07g01340.1 | upstream_gene_variant ; 2225.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700211553 | T -> C | LOC_Os07g01330-LOC_Os07g01340 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700211553 | 3.87E-07 | NA | mr1163 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700211553 | NA | 2.90E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700211553 | NA | 1.41E-06 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700211553 | NA | 3.67E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700211553 | NA | 1.04E-08 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |