\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700211553:

Variant ID: vg0700211553 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 211553
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTATTTTAAGGATTGCTATGATTCATATTTGTTACCGTGGGTACCAGCACTATGTCCTGGGACTGGTATCGAGATTGCGGTTTCTTAGGAAGCGGTTCG[T/C]
GCCGTTTTCCCCTACGACACGCTCCTGTCAGGTGCCGTTGTACGGCGGTACCAGATTGGGGTGTGACAGTTACTCTCGAATCGATGTAAATCGGTCTGAC

Reverse complement sequence

GTCAGACCGATTTACATCGATTCGAGAGTAACTGTCACACCCCAATCTGGTACCGCCGTACAACGGCACCTGACAGGAGCGTGTCGTAGGGGAAAACGGC[A/G]
CGAACCGCTTCCTAAGAAACCGCAATCTCGATACCAGTCCCAGGACATAGTGCTGGTACCCACGGTAACAAATATGAATCATAGCAATCCTTAAAATAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 11.30% 0.90% 12.61% 75.18% NA
All Indica  2759 1.90% 1.60% 16.31% 80.21% NA
All Japonica  1512 20.20% 0.00% 1.32% 78.44% NA
Aus  269 59.90% 0.40% 39.03% 0.74% NA
Indica I  595 0.30% 1.50% 16.64% 81.51% NA
Indica II  465 1.10% 0.40% 4.30% 94.19% NA
Indica III  913 2.60% 2.10% 24.75% 70.54% NA
Indica Intermediate  786 2.80% 1.70% 13.36% 82.19% NA
Temperate Japonica  767 22.70% 0.00% 1.04% 76.27% NA
Tropical Japonica  504 23.60% 0.00% 1.39% 75.00% NA
Japonica Intermediate  241 5.40% 0.00% 2.07% 92.53% NA
VI/Aromatic  96 2.10% 0.00% 7.29% 90.62% NA
Intermediate  90 12.20% 0.00% 15.56% 72.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700211553 T -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700211553 T -> C LOC_Os07g01330.1 upstream_gene_variant ; 2763.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700211553 T -> C LOC_Os07g01340.1 upstream_gene_variant ; 2225.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700211553 T -> C LOC_Os07g01330-LOC_Os07g01340 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700211553 3.87E-07 NA mr1163 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700211553 NA 2.90E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700211553 NA 1.41E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700211553 NA 3.67E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700211553 NA 1.04E-08 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251