\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700174113:

Variant ID: vg0700174113 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 174113
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATTAATTGCAATGACTTTATCTTTCAAAACAATTTGAGAAGACTTCACATCAACATGATTTGCAATCCAAGAAGAAAATTTGTTTGGGACATAAGCAT[T/C]
GTCAAACATCAGCAAAGAATTAAAACCATAGTCACCAATAATACGCTTCTGATCAGGAGATAAAGAAGATAGAACTGTTGAGAAATATTTTGTTGAGAAT

Reverse complement sequence

ATTCTCAACAAAATATTTCTCAACAGTTCTATCTTCTTTATCTCCTGATCAGAAGCGTATTATTGGTGACTATGGTTTTAATTCTTTGCTGATGTTTGAC[A/G]
ATGCTTATGTCCCAAACAAATTTTCTTCTTGGATTGCAAATCATGTTGATGTGAAGTCTTCTCAAATTGTTTTGAAAGATAAAGTCATTGCAATTAATAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.80% 10.50% 0.74% 32.88% NA
All Indica  2759 79.30% 8.80% 0.36% 11.53% NA
All Japonica  1512 24.30% 0.20% 1.46% 74.07% NA
Aus  269 11.90% 88.10% 0.00% 0.00% NA
Indica I  595 97.50% 0.70% 0.00% 1.85% NA
Indica II  465 50.80% 1.50% 0.65% 47.10% NA
Indica III  913 80.10% 19.30% 0.33% 0.33% NA
Indica Intermediate  786 81.60% 7.10% 0.51% 10.81% NA
Temperate Japonica  767 25.00% 0.00% 1.04% 73.92% NA
Tropical Japonica  504 30.40% 0.40% 1.98% 67.26% NA
Japonica Intermediate  241 9.10% 0.40% 1.66% 88.80% NA
VI/Aromatic  96 11.50% 6.20% 3.12% 79.17% NA
Intermediate  90 45.60% 10.00% 0.00% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700174113 T -> DEL LOC_Os07g01280.1 N frameshift_variant Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700174113 T -> C LOC_Os07g01280.1 missense_variant ; p.Asn236Asp; MODERATE nonsynonymous_codon Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 benign 1.154 TOLERATED 0.46

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700174113 NA 5.91E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 5.60E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 1.42E-18 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 1.59E-28 mr1168 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 2.61E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 1.11E-24 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 1.50E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 9.82E-19 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 3.89E-13 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 1.07E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 4.77E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 5.77E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 2.01E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 2.49E-21 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 4.45E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 1.83E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 6.69E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 3.39E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700174113 NA 1.24E-08 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251