\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700121974:

Variant ID: vg0700121974 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 121974
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTTTTAAGATCATTCACTTTTGGTAATACAGAAGGAATCATATAAGAAATATGTATAAAAAACCTCGCATGCTAACTTGAGACGATTGGACTGCTAAC[C/T]
GTAGCTCATGATTTTCTAAAATATATATATATCCATGCGAACTTCGCTCCAATAGTGAATTTTATCTTAACTAAATCATATAACAATAATGAGATTAAAA

Reverse complement sequence

TTTTAATCTCATTATTGTTATATGATTTAGTTAAGATAAAATTCACTATTGGAGCGAAGTTCGCATGGATATATATATATTTTAGAAAATCATGAGCTAC[G/A]
GTTAGCAGTCCAATCGTCTCAAGTTAGCATGCGAGGTTTTTTATACATATTTCTTATATGATTCCTTCTGTATTACCAAAAGTGAATGATCTTAAAAACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.50% 19.80% 0.80% 35.89% NA
All Indica  2759 38.50% 2.10% 0.94% 58.46% NA
All Japonica  1512 41.00% 56.50% 0.46% 1.98% NA
Aus  269 90.00% 0.70% 0.37% 8.92% NA
Indica I  595 50.80% 2.90% 1.18% 45.21% NA
Indica II  465 52.30% 2.20% 0.86% 44.73% NA
Indica III  913 28.60% 2.20% 0.22% 69.00% NA
Indica Intermediate  786 32.40% 1.50% 1.65% 64.38% NA
Temperate Japonica  767 15.90% 83.30% 0.39% 0.39% NA
Tropical Japonica  504 68.10% 26.40% 0.60% 4.96% NA
Japonica Intermediate  241 64.30% 34.40% 0.41% 0.83% NA
VI/Aromatic  96 92.70% 2.10% 0.00% 5.21% NA
Intermediate  90 48.90% 20.00% 4.44% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700121974 C -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700121974 C -> T LOC_Os07g01200.1 upstream_gene_variant ; 3919.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700121974 C -> T LOC_Os07g01214.1 upstream_gene_variant ; 281.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700121974 C -> T LOC_Os07g01200.2 upstream_gene_variant ; 4232.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700121974 C -> T LOC_Os07g01200-LOC_Os07g01214 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700121974 2.85E-07 1.83E-10 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700121974 NA 2.94E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700121974 NA 4.84E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700121974 5.96E-07 8.86E-10 mr1316 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700121974 NA 5.02E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700121974 5.30E-07 8.16E-10 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700121974 NA 8.12E-06 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700121974 NA 2.65E-07 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700121974 NA 2.38E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700121974 NA 4.85E-09 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700121974 3.56E-06 4.42E-10 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700121974 9.14E-06 8.60E-08 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700121974 NA 6.29E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700121974 8.40E-07 2.43E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700121974 NA 3.85E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251