\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700118960:

Variant ID: vg0700118960 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 118960
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GAATTTGCATGCGTGACACTGTGTTCTTTGACTGGCTACATCATTTTTTTTTTGCACTTATCCTGATCATTTGCATATTATGTGCCTGTTTACTTTGATG[C/T]
CATTTTCAACCTTACCAAATTTTGGTAAAGTTGACAAAAAAGTGGCTACATTTAGTTCGCTGCCAAATTTTGATATAAGAAATCCTACCAAAATTTTAAC

Reverse complement sequence

GTTAAAATTTTGGTAGGATTTCTTATATCAAAATTTGGCAGCGAACTAAATGTAGCCACTTTTTTGTCAACTTTACCAAAATTTGGTAAGGTTGAAAATG[G/A]
CATCAAAGTAAACAGGCACATAATATGCAAATGATCAGGATAAGTGCAAAAAAAAAATGATGTAGCCAGTCAAAGAACACAGTGTCACGCATGCAAATTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 46.60% 0.40% 0.00% NA
All Indica  2759 22.50% 77.20% 0.36% 0.00% NA
All Japonica  1512 97.20% 2.40% 0.40% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 1.20% 98.50% 0.34% 0.00% NA
Indica II  465 52.90% 46.50% 0.65% 0.00% NA
Indica III  913 22.80% 77.20% 0.00% 0.00% NA
Indica Intermediate  786 20.20% 79.10% 0.64% 0.00% NA
Temperate Japonica  767 98.60% 1.00% 0.39% 0.00% NA
Tropical Japonica  504 94.40% 5.00% 0.60% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 70.00% 27.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700118960 C -> T LOC_Os07g01190.1 upstream_gene_variant ; 4637.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700118960 C -> T LOC_Os07g01200.1 upstream_gene_variant ; 905.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700118960 C -> T LOC_Os07g01214.1 upstream_gene_variant ; 3295.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700118960 C -> T LOC_Os07g01200.2 upstream_gene_variant ; 1218.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700118960 C -> T LOC_Os07g01200-LOC_Os07g01214 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700118960 1.22E-06 NA mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 6.13E-07 1.84E-08 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 NA 6.02E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 2.56E-06 NA mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 1.67E-06 7.12E-09 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 NA 4.63E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 NA 9.67E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 NA 1.08E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 2.08E-06 3.59E-08 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 1.79E-06 3.15E-14 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 5.05E-06 NA mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 3.25E-06 5.19E-07 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 3.07E-07 NA mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 1.09E-09 2.52E-17 mr1383_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 NA 1.91E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 NA 4.78E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700118960 NA 2.37E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251