\
| Variant ID: vg0700118813 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 118813 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGAATAGTACTTTACTTGTAACTTATGTTTTTAATTTTTTTCAAAAAATTTTCAAATAAAACGAACGGTCAAAGTTGGGCGTGGAAAACCATGGCTGCA[C/T]
TTATTTTGGGACGGAGGAAGTATCAGCCAAAAATTCGGCCTTTTTTGAATTTGCATGCGTGACACTGTGTTCTTTGACTGGCTACATCATTTTTTTTTTG
CAAAAAAAAAATGATGTAGCCAGTCAAAGAACACAGTGTCACGCATGCAAATTCAAAAAAGGCCGAATTTTTGGCTGATACTTCCTCCGTCCCAAAATAA[G/A]
TGCAGCCATGGTTTTCCACGCCCAACTTTGACCGTTCGTTTTATTTGAAAATTTTTTGAAAAAAATTAAAAACATAAGTTACAAGTAAAGTACTATTCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.00% | 11.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 90.40% | 9.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 11.50% | 88.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 78.50% | 21.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700118813 | C -> T | LOC_Os07g01190.1 | upstream_gene_variant ; 4490.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700118813 | C -> T | LOC_Os07g01200.1 | upstream_gene_variant ; 758.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700118813 | C -> T | LOC_Os07g01214.1 | upstream_gene_variant ; 3442.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700118813 | C -> T | LOC_Os07g01200.2 | upstream_gene_variant ; 1071.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700118813 | C -> T | LOC_Os07g01200-LOC_Os07g01214 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700118813 | NA | 9.14E-08 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700118813 | NA | 1.65E-17 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700118813 | NA | 1.19E-21 | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700118813 | NA | 5.80E-20 | mr1158 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700118813 | NA | 1.85E-25 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700118813 | NA | 1.67E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700118813 | NA | 1.02E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700118813 | NA | 6.19E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700118813 | NA | 9.23E-09 | mr1465 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700118813 | NA | 8.78E-06 | mr1512 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700118813 | NA | 8.41E-13 | mr1612 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700118813 | NA | 1.39E-06 | mr1787 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700118813 | NA | 5.91E-21 | mr1817 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700118813 | NA | 1.07E-08 | mr1939 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700118813 | NA | 6.86E-18 | mr1817_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |