\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700107314:

Variant ID: vg0700107314 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 107314
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTTGCTTCCTCCCTGTGACCATCTGATCAACATCACAAGCATACACACATTCGTAGTACAGTAGTATGTAATACTCCCTCCATCCCAAAATATTTGAC[G/A]
CCGTTGACTTTTTTAAATATGTTTCACCGTTCGTCTTATTTAAAAAATTTAAGTAATTATTAATTCTTTTTCTATCATTTGATTTATTGCTAAATATACT

Reverse complement sequence

AGTATATTTAGCAATAAATCAAATGATAGAAAAAGAATTAATAATTACTTAAATTTTTTAAATAAGACGAACGGTGAAACATATTTAAAAAAGTCAACGG[C/T]
GTCAAATATTTTGGGATGGAGGGAGTATTACATACTACTGTACTACGAATGTGTGTATGCTTGTGATGTTGATCAGATGGTCACAGGGAGGAAGCAAACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 47.70% 0.25% 0.00% NA
All Indica  2759 30.30% 69.40% 0.36% 0.00% NA
All Japonica  1512 97.80% 2.20% 0.07% 0.00% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 53.30% 46.40% 0.34% 0.00% NA
Indica II  465 51.80% 47.70% 0.43% 0.00% NA
Indica III  913 8.30% 91.70% 0.00% 0.00% NA
Indica Intermediate  786 25.60% 73.70% 0.76% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 94.20% 5.60% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700107314 G -> A LOC_Os07g01170.1 upstream_gene_variant ; 2066.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700107314 G -> A LOC_Os07g01180.1 upstream_gene_variant ; 1972.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700107314 G -> A LOC_Os07g01170-LOC_Os07g01180 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0700107314 G A 0.1 -0.01 -0.01 0.02 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700107314 3.32E-06 1.62E-09 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700107314 1.18E-06 2.15E-09 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700107314 NA 1.11E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700107314 3.25E-06 7.42E-09 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700107314 NA 2.02E-06 mr1614 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700107314 7.80E-06 7.80E-06 mr1941 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700107314 NA 6.31E-09 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700107314 NA 9.43E-07 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251