\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700072352:

Variant ID: vg0700072352 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 72352
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, C: 0.49, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGATAGCAGCTAGATAGGTTATCCCAAATATTGTACTTGTGTGATTGTAATGAATATATAGCAACACTGACTTCTGCCAACAGAAGCAGGGCTATTAC[C/T]
TGTTAGATAAGAGCCCCTAACATGTATAAAAATCCTTGTCTCCATCTCTTTTACCTTAATCTCGCATATACCCTGGTATCGACGATCTCTATACCATACA

Reverse complement sequence

TGTATGGTATAGAGATCGTCGATACCAGGGTATATGCGAGATTAAGGTAAAAGAGATGGAGACAAGGATTTTTATACATGTTAGGGGCTCTTATCTAACA[G/A]
GTAATAGCCCTGCTTCTGTTGGCAGAAGTCAGTGTTGCTATATATTCATTACAATCACACAAGTACAATATTTGGGATAACCTATCTAGCTGCTATCAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 32.10% 0.17% 0.00% NA
All Indica  2759 71.20% 28.60% 0.18% 0.00% NA
All Japonica  1512 59.60% 40.30% 0.13% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 49.20% 50.60% 0.17% 0.00% NA
Indica II  465 49.50% 50.30% 0.22% 0.00% NA
Indica III  913 92.80% 7.20% 0.00% 0.00% NA
Indica Intermediate  786 75.70% 23.90% 0.38% 0.00% NA
Temperate Japonica  767 84.90% 15.10% 0.00% 0.00% NA
Tropical Japonica  504 32.30% 67.50% 0.20% 0.00% NA
Japonica Intermediate  241 36.10% 63.50% 0.41% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700072352 C -> T LOC_Os07g01114.1 upstream_gene_variant ; 4544.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700072352 C -> T LOC_Os07g01130.1 upstream_gene_variant ; 810.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700072352 C -> T LOC_Os07g01120.1 downstream_gene_variant ; 1461.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700072352 C -> T LOC_Os07g01120-LOC_Os07g01130 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0700072352 C T 0.0 -0.02 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700072352 NA 2.10E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0700072352 NA 7.97E-06 mr1115 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700072352 4.79E-06 5.24E-09 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700072352 NA 6.02E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700072352 6.27E-07 9.80E-10 mr1316 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700072352 NA 1.94E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700072352 5.32E-06 1.13E-08 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700072352 NA 2.51E-06 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700072352 NA 1.55E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700072352 NA 7.32E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700072352 NA 5.48E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700072352 NA 3.13E-09 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700072352 NA 4.39E-06 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700072352 NA 9.83E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700072352 NA 2.83E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251