Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700071969:

Variant ID: vg0700071969 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 71969
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCTTTCCCAATCGCTCACTCACTGACTCACTCTCTCTCTCTCCTCCATCTCCTTAGCTCCATTGGAGGACAACGACGGAGGCAGCTGGGCGATAGAGG[G/A]
GAGCCGAGGACTCCGTTGTGTAGGGCGGAGCCAAGGATGGCGACGCGCCTCTGCCCCCGCTGCTGGCCGCACGAGCGACCTCTGCCTCCTACACCGGCAC

Reverse complement sequence

GTGCCGGTGTAGGAGGCAGAGGTCGCTCGTGCGGCCAGCAGCGGGGGCAGAGGCGCGTCGCCATCCTTGGCTCCGCCCTACACAACGGAGTCCTCGGCTC[C/T]
CCTCTATCGCCCAGCTGCCTCCGTCGTTGTCCTCCAATGGAGCTAAGGAGATGGAGGAGAGAGAGAGAGTGAGTCAGTGAGTGAGCGATTGGGAAAGAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 36.30% 0.49% 0.51% NA
All Indica  2759 38.70% 59.90% 0.69% 0.72% NA
All Japonica  1512 97.40% 2.20% 0.20% 0.26% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 53.10% 46.20% 0.67% 0.00% NA
Indica II  465 49.20% 46.50% 1.08% 3.23% NA
Indica III  913 29.60% 69.90% 0.44% 0.11% NA
Indica Intermediate  786 32.10% 66.70% 0.76% 0.51% NA
Temperate Japonica  767 99.20% 0.50% 0.13% 0.13% NA
Tropical Japonica  504 93.80% 5.40% 0.20% 0.60% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700071969 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700071969 G -> A LOC_Os07g01114.1 upstream_gene_variant ; 4161.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700071969 G -> A LOC_Os07g01130.1 upstream_gene_variant ; 1193.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700071969 G -> A LOC_Os07g01120.1 downstream_gene_variant ; 1078.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700071969 G -> A LOC_Os07g01120-LOC_Os07g01130 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0700071969 G A -0.01 -0.02 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700071969 NA 6.55E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0700071969 8.95E-08 NA mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 4.58E-08 5.97E-11 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 NA 6.49E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 NA 5.63E-13 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 6.95E-06 1.09E-08 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 NA 5.34E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 3.94E-07 NA mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 1.21E-06 3.69E-09 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 NA 5.77E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 NA 5.21E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 NA 4.85E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 1.16E-07 1.10E-09 mr1158_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 3.15E-06 4.08E-10 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 4.92E-06 NA mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 NA 1.08E-07 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 NA 2.79E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 3.18E-06 NA mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 1.02E-06 3.36E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 NA 4.11E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700071969 NA 5.19E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251