Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700016965:

Variant ID: vg0700016965 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16965
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAATTTCAGAAAACTGAAATTATAGTGATAAAACTATCAATTTGCTACAAATTAGTTATCTATTTTAGTTTGTTGCAACAATAGCATGGGAAGTTATCA[T/C]
AAAACTGTAACTTTTACGTGATATGCTGCTACAGTACGTGATATGCTGCTACAATTGTCATGTAGTAGCATATCACGTAAAAGTTGCAGTTTTGTGATAA

Reverse complement sequence

TTATCACAAAACTGCAACTTTTACGTGATATGCTACTACATGACAATTGTAGCAGCATATCACGTACTGTAGCAGCATATCACGTAAAAGTTACAGTTTT[A/G]
TGATAACTTCCCATGCTATTGTTGCAACAAACTAAAATAGATAACTAATTTGTAGCAAATTGATAGTTTTATCACTATAATTTCAGTTTTCTGAAATTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.80%	15.00%	0.25%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	54.20%	45.00%	0.73%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	21.00%	78.00%	1.04%	0.00%	NA
Tropical Japonica	504	96.60%	3.00%	0.40%	0.00%	NA
Japonica Intermediate	241	71.40%	28.20%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0700016965	T -> C	LOC_Os07g01020.1	upstream_gene_variant ; 3979.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700016965	T -> C	LOC_Os07g01030.1	upstream_gene_variant ; 550.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700016965	T -> C	LOC_Os07g01020-LOC_Os07g01030	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0700016965	NA	2.98E-29	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016965	NA	7.08E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016965	NA	1.96E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016965	2.25E-06	NA	mr1672	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016965	NA	2.87E-06	mr1672	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016965	NA	6.03E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016965	NA	1.08E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016965	NA	2.12E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016965	NA	3.03E-34	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016965	NA	6.01E-09	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251