Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700016817:

Variant ID: vg0700016817 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16817
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGTAACCAAGTAATTTTTATTTTAGTTTAGATAGCGTAGTACGTATAGAATTTTGTTCTAGAATCTATGTGATTTTAGAAACGTTTGATTATTTTATT[G/A]
GCATAAATTAGGAGTTTTTCCTATCATGCATGTTTTTTTTCTAAGAGTAAATTTCAGAAAACTGAAATTATAGTGATAAAACTATCAATTTGCTACAAAT

Reverse complement sequence

ATTTGTAGCAAATTGATAGTTTTATCACTATAATTTCAGTTTTCTGAAATTTACTCTTAGAAAAAAAACATGCATGATAGGAAAAACTCCTAATTTATGC[C/T]
AATAAAATAATCAAACGTTTCTAAAATCACATAGATTCTAGAACAAAATTCTATACGTACTACGCTATCTAAACTAAAATAAAAATTACTTGGTTACCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.40% 46.60% 0.04% 0.00% NA
All Indica  2759 22.70% 77.30% 0.04% 0.00% NA
All Japonica  1512 97.90% 2.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 2.70% 97.30% 0.00% 0.00% NA
Indica II  465 53.10% 46.90% 0.00% 0.00% NA
Indica III  913 22.60% 77.40% 0.00% 0.00% NA
Indica Intermediate  786 19.80% 80.00% 0.13% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 94.80% 5.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700016817 G -> A LOC_Os07g01020.1 upstream_gene_variant ; 3831.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700016817 G -> A LOC_Os07g01030.1 upstream_gene_variant ; 698.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700016817 G -> A LOC_Os07g01020-LOC_Os07g01030 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700016817 NA 1.64E-13 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016817 1.09E-06 NA mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016817 3.46E-06 8.45E-08 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016817 4.20E-06 NA mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016817 NA 8.58E-08 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016817 NA 7.24E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016817 3.61E-06 3.19E-08 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016817 NA 1.22E-12 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016817 3.47E-07 NA mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016817 6.86E-07 2.07E-07 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016817 2.79E-08 NA mr1383_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016817 1.00E-08 5.16E-16 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016817 NA 2.06E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016817 2.71E-06 NA mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700016817 5.17E-06 NA mr1817_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251