\
| Variant ID: vg0700016817 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16817 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 213. )
TTGGTAACCAAGTAATTTTTATTTTAGTTTAGATAGCGTAGTACGTATAGAATTTTGTTCTAGAATCTATGTGATTTTAGAAACGTTTGATTATTTTATT[G/A]
GCATAAATTAGGAGTTTTTCCTATCATGCATGTTTTTTTTCTAAGAGTAAATTTCAGAAAACTGAAATTATAGTGATAAAACTATCAATTTGCTACAAAT
ATTTGTAGCAAATTGATAGTTTTATCACTATAATTTCAGTTTTCTGAAATTTACTCTTAGAAAAAAAACATGCATGATAGGAAAAACTCCTAATTTATGC[C/T]
AATAAAATAATCAAACGTTTCTAAAATCACATAGATTCTAGAACAAAATTCTATACGTACTACGCTATCTAAACTAAAATAAAAATTACTTGGTTACCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.40% | 46.60% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 22.70% | 77.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 2.70% | 97.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 22.60% | 77.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 19.80% | 80.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700016817 | G -> A | LOC_Os07g01020.1 | upstream_gene_variant ; 3831.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700016817 | G -> A | LOC_Os07g01030.1 | upstream_gene_variant ; 698.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700016817 | G -> A | LOC_Os07g01020-LOC_Os07g01030 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700016817 | NA | 1.64E-13 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700016817 | 1.09E-06 | NA | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700016817 | 3.46E-06 | 8.45E-08 | mr1158 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700016817 | 4.20E-06 | NA | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700016817 | NA | 8.58E-08 | mr1383 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700016817 | NA | 7.24E-06 | mr1608 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700016817 | 3.61E-06 | 3.19E-08 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700016817 | NA | 1.22E-12 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700016817 | 3.47E-07 | NA | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700016817 | 6.86E-07 | 2.07E-07 | mr1168_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700016817 | 2.79E-08 | NA | mr1383_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700016817 | 1.00E-08 | 5.16E-16 | mr1383_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700016817 | NA | 2.06E-06 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700016817 | 2.71E-06 | NA | mr1817_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700016817 | 5.17E-06 | NA | mr1817_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |