Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0700009625:

Variant ID: vg0700009625 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9625
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.50, A: 0.50, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAACCACCATAAACCATTGTTACCTCTACAGGCTCCTCTGCCACCCTACAAGATCACTCCAAACCTTCGGCATGGCATCTGAACTAGCTGGAACTTGA[A/C]
ACTACAGGCACATGGCACTGCATTGTACATGACCTGAGGAGAACAAGGTGAAGGGGCCTCAACGTCGCCAAGAGCATCACCGGAGTGGGGTAGTGCATGT

Reverse complement sequence

ACATGCACTACCCCACTCCGGTGATGCTCTTGGCGACGTTGAGGCCCCTTCACCTTGTTCTCCTCAGGTCATGTACAATGCAGTGCCATGTGCCTGTAGT[T/G]
TCAAGTTCCAGCTAGTTCAGATGCCATGCCGAAGGTTTGGAGTGATCTTGTAGGGTGGCAGAGGAGCCTGTAGAGGTAACAATGGTTTATGGTGGTTCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.10% 19.70% 0.47% 56.71% NA
All Indica  2759 12.70% 1.60% 0.62% 85.07% NA
All Japonica  1512 41.10% 56.70% 0.20% 1.92% NA
Aus  269 0.40% 1.50% 0.37% 97.77% NA
Indica I  595 0.70% 2.50% 0.84% 95.97% NA
Indica II  465 51.40% 0.90% 0.43% 47.31% NA
Indica III  913 0.50% 1.30% 0.44% 97.70% NA
Indica Intermediate  786 13.00% 1.80% 0.76% 84.48% NA
Temperate Japonica  767 15.60% 84.00% 0.13% 0.26% NA
Tropical Japonica  504 68.70% 26.00% 0.40% 4.96% NA
Japonica Intermediate  241 64.70% 34.40% 0.00% 0.83% NA
VI/Aromatic  96 87.50% 1.00% 0.00% 11.46% NA
Intermediate  90 41.10% 24.40% 1.11% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700009625 A -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700009625 A -> C LOC_Os07g01020.1 downstream_gene_variant ; 1947.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700009625 A -> C LOC_Os07g01010-LOC_Os07g01020 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0700009625 A C -0.04 -0.02 -0.01 0.0 -0.07 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700009625 9.38E-07 5.07E-09 mr1158 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700009625 NA 1.41E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700009625 NA 1.28E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700009625 NA 7.60E-07 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700009625 NA 2.00E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700009625 NA 1.67E-09 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700009625 NA 1.34E-07 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700009625 NA 3.70E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700009625 NA 1.31E-09 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251