\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700008597:

Variant ID: vg0700008597 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 8597
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTCATAGCTGAATTCTGGCAACCCTAGAATTTAGTTAATCATTATTGTTTTACGCTGAAAAACGGTCGTGCTTCTCCATGAAAGCGAGGTTATCCTTT[G/A]
CTAGTTTGCTTGGAAACTAGTCGTTCGTCGTCACGTTAGTACGATATTTATTTTCTTTGCTAATTTGCTTGTAAATTAGTCGCTTGATTCCGCATAAGTG

Reverse complement sequence

CACTTATGCGGAATCAAGCGACTAATTTACAAGCAAATTAGCAAAGAAAATAAATATCGTACTAACGTGACGACGAACGACTAGTTTCCAAGCAAACTAG[C/T]
AAAGGATAACCTCGCTTTCATGGAGAAGCACGACCGTTTTTCAGCGTAAAACAATAATGATTAACTAAATTCTAGGGTTGCCAGAATTCAGCTATGAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.10% 0.10% 0.61% 56.09% NA
All Indica  2759 15.00% 0.10% 0.94% 84.02% NA
All Japonica  1512 97.70% 0.30% 0.00% 1.98% NA
Aus  269 1.90% 0.00% 0.74% 97.40% NA
Indica I  595 4.40% 0.20% 1.34% 94.12% NA
Indica II  465 53.50% 0.00% 0.65% 45.81% NA
Indica III  913 2.00% 0.10% 0.99% 96.93% NA
Indica Intermediate  786 15.30% 0.00% 0.76% 83.97% NA
Temperate Japonica  767 99.30% 0.40% 0.00% 0.26% NA
Tropical Japonica  504 94.80% 0.00% 0.00% 5.16% NA
Japonica Intermediate  241 98.30% 0.80% 0.00% 0.83% NA
VI/Aromatic  96 88.50% 0.00% 0.00% 11.46% NA
Intermediate  90 65.60% 0.00% 1.11% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700008597 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700008597 G -> A LOC_Os07g01020.1 downstream_gene_variant ; 2975.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700008597 G -> A LOC_Os07g01010-LOC_Os07g01020 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700008597 NA 2.66E-07 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700008597 NA 2.23E-07 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700008597 NA 8.55E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700008597 NA 1.30E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700008597 1.66E-06 4.31E-09 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700008597 2.38E-06 1.73E-13 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700008597 9.10E-06 NA mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700008597 8.61E-07 5.19E-08 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700008597 2.84E-07 NA mr1383_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700008597 4.53E-09 1.09E-14 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700008597 NA 6.85E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251