\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0631238601:

Variant ID: vg0631238601 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 31238601
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATTGACCTAAATTGGAGCAGTAACAATATGATTTAGGGTCCCGTTATTGGAAGACGCCGGTAAAACCCAATACACAGGCTAAGAAATCAGAGAAAACG[G/C]
CTCAGAAGAAGCCATTGCCTACACCTAAGATGAATGTGTGGCAAGTGAAGCGAAAGACGCCCACTCCATCACCTCTAGAGATGGGTGGAAAATCCGCGAA

Reverse complement sequence

TTCGCGGATTTTCCACCCATCTCTAGAGGTGATGGAGTGGGCGTCTTTCGCTTCACTTGCCACACATTCATCTTAGGTGTAGGCAATGGCTTCTTCTGAG[C/G]
CGTTTTCTCTGATTTCTTAGCCTGTGTATTGGGTTTTACCGGCGTCTTCCAATAACGGGACCCTAAATCATATTGTTACTGCTCCAATTTAGGTCAATGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.80% 5.40% 0.32% 57.45% NA
All Indica  2759 7.10% 2.00% 0.47% 90.36% NA
All Japonica  1512 92.40% 0.10% 0.13% 7.34% NA
Aus  269 4.80% 69.10% 0.00% 26.02% NA
Indica I  595 8.60% 0.20% 1.01% 90.25% NA
Indica II  465 8.60% 0.60% 0.22% 90.54% NA
Indica III  913 2.50% 3.40% 0.44% 93.65% NA
Indica Intermediate  786 10.60% 2.70% 0.25% 86.51% NA
Temperate Japonica  767 96.10% 0.00% 0.00% 3.91% NA
Tropical Japonica  504 85.30% 0.20% 0.40% 14.09% NA
Japonica Intermediate  241 95.40% 0.40% 0.00% 4.15% NA
VI/Aromatic  96 92.70% 6.20% 0.00% 1.04% NA
Intermediate  90 50.00% 5.60% 0.00% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0631238601 G -> C LOC_Os06g51560.1 upstream_gene_variant ; 805.0bp to feature; MODIFIER silent_mutation Average:10.674; most accessible tissue: Callus, score: 46.082 N N N N
vg0631238601 G -> C LOC_Os06g51550.1 downstream_gene_variant ; 662.0bp to feature; MODIFIER silent_mutation Average:10.674; most accessible tissue: Callus, score: 46.082 N N N N
vg0631238601 G -> C LOC_Os06g51570.1 downstream_gene_variant ; 4106.0bp to feature; MODIFIER silent_mutation Average:10.674; most accessible tissue: Callus, score: 46.082 N N N N
vg0631238601 G -> C LOC_Os06g51550-LOC_Os06g51560 intergenic_region ; MODIFIER silent_mutation Average:10.674; most accessible tissue: Callus, score: 46.082 N N N N
vg0631238601 G -> DEL N N silent_mutation Average:10.674; most accessible tissue: Callus, score: 46.082 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0631238601 NA 3.23E-104 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 2.00E-102 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 1.41E-74 mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 2.20E-60 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 1.76E-44 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 5.59E-83 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 9.02E-83 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 2.95E-44 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 4.06E-21 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 7.62E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 1.32E-24 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 8.13E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 6.93E-93 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 2.84E-88 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 9.65E-68 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 1.35E-46 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 1.10E-33 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 2.07E-87 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 1.92E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 3.58E-90 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 3.28E-73 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 1.13E-68 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 2.24E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 4.05E-88 mr1504_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 6.90E-104 mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 2.95E-36 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 5.03E-79 mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 2.63E-46 mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631238601 NA 2.48E-124 mr1672_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251