Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0631235279:

Variant ID: vg0631235279 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 31235279
Reference Allele: T	Alternative Allele: G,C
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

CAGTATGGGTTTATCAAGACTAAAACAATTCAAGATTGTTTGGGTTGGGCTTTTGAATATTTGCATCAATGCAAACATTCTAAGAGGGAAATTGTTTTGT[T/G,C]
AAAGCTGGATTTTGAAAAAGCTTTTGACATGATTGAACATTCAGCGGTGCTCCAAGTTATGACATCAATGGGCTTTCCTCCTAAATGGACTGAGTGGGTT

Reverse complement sequence

AACCCACTCAGTCCATTTAGGAGGAAAGCCCATTGATGTCATAACTTGGAGCACCGCTGAATGTTCAATCATGTCAAAAGCTTTTTCAAAATCCAGCTTT[A/C,G]
ACAAAACAATTTCCCTCTTAGAATGTTTGCATTGATGCAAATATTCAAAAGCCCAACCCAAACAATCTTGAATTGTTTTAGTCTTGATAAACCCATACTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.30%	9.50%	3.77%	1.46%	NA
All Indica	2759	80.00%	15.70%	4.35%	0.00%	NA
All Japonica	1512	92.50%	0.40%	2.78%	4.37%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	68.20%	25.00%	6.72%	0.00%	NA
Indica II	465	68.80%	25.20%	6.02%	0.00%	NA
Indica III	913	98.80%	0.50%	0.66%	0.00%	NA
Indica Intermediate	786	73.50%	20.60%	5.85%	0.00%	NA
Temperate Japonica	767	96.10%	0.50%	2.22%	1.17%	NA
Tropical Japonica	504	86.10%	0.00%	3.77%	10.12%	NA
Japonica Intermediate	241	94.20%	0.80%	2.49%	2.49%	NA
VI/Aromatic	96	95.80%	0.00%	4.17%	0.00%	NA
Intermediate	90	74.40%	8.90%	13.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0631235279	T -> C	LOC_Os06g51550.1	missense_variant ; p.Leu50Ser; MODERATE	N	Average:45.306; most accessible tissue: Zhenshan97 young leaf, score: 68.794	N	N	N	N
vg0631235279	T -> C	LOC_Os06g51560.1	upstream_gene_variant ; 4127.0bp to feature; MODIFIER	N	Average:45.306; most accessible tissue: Zhenshan97 young leaf, score: 68.794	N	N	N	N
vg0631235279	T -> G	LOC_Os06g51550.1	stop_gained ; p.Leu50*; HIGH	stop_gained	Average:45.306; most accessible tissue: Zhenshan97 young leaf, score: 68.794	N	N	N	N
vg0631235279	T -> DEL	LOC_Os06g51550.1	N	frameshift_variant	Average:45.306; most accessible tissue: Zhenshan97 young leaf, score: 68.794	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0631235279	NA	3.62E-07	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	4.27E-07	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	1.10E-12	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	3.95E-06	NA	mr1129	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	2.76E-12	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	5.10E-07	mr1235	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	4.51E-06	6.13E-25	mr1251	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	3.40E-06	2.62E-12	mr1251	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	2.09E-06	mr1253	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	7.51E-21	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	5.89E-10	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	4.58E-10	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	3.22E-08	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	6.29E-06	NA	mr1435	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	7.88E-06	2.16E-11	mr1435	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	1.75E-06	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	2.24E-07	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	3.09E-07	NA	mr1599	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	6.74E-07	1.35E-10	mr1599	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	6.02E-10	mr1089_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	2.36E-08	mr1093_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	1.85E-06	NA	mr1109_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	7.98E-17	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	1.21E-14	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	1.06E-07	mr1235_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	4.77E-08	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	1.90E-08	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	2.16E-06	mr1243_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	1.23E-13	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	1.44E-08	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	4.92E-24	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	1.93E-12	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	6.75E-06	1.68E-34	mr1257_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	1.94E-16	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	9.44E-12	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	2.82E-07	mr1377_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	2.36E-07	mr1423_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	1.30E-13	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	9.40E-07	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	1.01E-12	mr1599_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	8.10E-08	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631235279	NA	2.13E-06	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251