\
| Variant ID: vg0631227245 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 31227245 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGATCAGGTGCAGTCGTTGTGGATCACCCTATGGCCAAAGTTGCAGTCGCTATAGGGACTGCACCTGATCCCGATCCCTAAAAATATGTTTTTCAGCAGC[G/A]
GCAACGCCTCGACGTGTGCACCGGCCTACTTCACCACAAGCTCATCAGGTGTAGTAGTGTGTTGCCATGATATTTAGGCTGTGTTTAGGGGGTGTTTAGA
TCTAAACACCCCCTAAACACAGCCTAAATATCATGGCAACACACTACTACACCTGATGAGCTTGTGGTGAAGTAGGCCGGTGCACACGTCGAGGCGTTGC[C/T]
GCTGCTGAAAAACATATTTTTAGGGATCGGGATCAGGTGCAGTCCCTATAGCGACTGCAACTTTGGCCATAGGGTGATCCACAACGACTGCACCTGATCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.20% | 5.40% | 0.21% | 62.21% | NA |
| All Indica | 2759 | 2.70% | 2.00% | 0.33% | 95.00% | NA |
| All Japonica | 1512 | 87.90% | 0.10% | 0.07% | 11.90% | NA |
| Aus | 269 | 0.40% | 69.50% | 0.00% | 30.11% | NA |
| Indica I | 595 | 3.90% | 0.00% | 0.50% | 95.63% | NA |
| Indica II | 465 | 2.60% | 0.60% | 0.22% | 96.56% | NA |
| Indica III | 913 | 1.50% | 3.40% | 0.00% | 95.07% | NA |
| Indica Intermediate | 786 | 3.30% | 2.50% | 0.64% | 93.51% | NA |
| Temperate Japonica | 767 | 93.90% | 0.00% | 0.13% | 6.00% | NA |
| Tropical Japonica | 504 | 78.20% | 0.20% | 0.00% | 21.63% | NA |
| Japonica Intermediate | 241 | 89.20% | 0.40% | 0.00% | 10.37% | NA |
| VI/Aromatic | 96 | 87.50% | 6.20% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 36.70% | 5.60% | 0.00% | 57.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0631227245 | G -> A | LOC_Os06g51530.1 | upstream_gene_variant ; 659.0bp to feature; MODIFIER | silent_mutation | Average:15.132; most accessible tissue: Callus, score: 85.937 | N | N | N | N |
| vg0631227245 | G -> A | LOC_Os06g51540.1 | upstream_gene_variant ; 864.0bp to feature; MODIFIER | silent_mutation | Average:15.132; most accessible tissue: Callus, score: 85.937 | N | N | N | N |
| vg0631227245 | G -> A | LOC_Os06g51530-LOC_Os06g51540 | intergenic_region ; MODIFIER | silent_mutation | Average:15.132; most accessible tissue: Callus, score: 85.937 | N | N | N | N |
| vg0631227245 | G -> DEL | N | N | silent_mutation | Average:15.132; most accessible tissue: Callus, score: 85.937 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0631227245 | NA | 3.85E-24 | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 8.71E-10 | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 6.60E-08 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 6.12E-08 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 9.53E-10 | mr1608 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 1.78E-06 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 4.90E-22 | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 2.04E-14 | mr1897 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 2.48E-15 | mr1927 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 7.94E-22 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 1.84E-10 | mr1317_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 3.86E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 1.35E-11 | mr1610_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 1.45E-09 | mr1818_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 1.22E-25 | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 1.04E-11 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 1.92E-14 | mr1914_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631227245 | NA | 1.17E-18 | mr1927_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |