\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0631211794:

Variant ID: vg0631211794 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 31211794
Reference Allele: TAlternative Allele: C,TATATTCATATTCATATTCCATATTCATATTGATTATTCTATATAGTC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGAGATTCTTCAAAATGCCACTAGGGCCAAAAACTTTTGAACTAAAGCTAGAGTGAAGATGAAATATGATACTCCCTCCATTTTACAATGTAAGTCATT[T/C,TATATTCATATTCATATTCCATATTCATATTGATTATTCTATATAGTC]
TAGCATTTTCCATATTCATATTGATGCTAGATTCATTAACGGGAAATGCTAGAATGACTTACATTGTGAAACGGAGGAAGTATATGTCAATGATGTACTT

Reverse complement sequence

AAGTACATCATTGACATATACTTCCTCCGTTTCACAATGTAAGTCATTCTAGCATTTCCCGTTAATGAATCTAGCATCAATATGAATATGGAAAATGCTA[A/G,GACTATATAGAATAATCAATATGAATATGGAATATGAATATGAATATA]
AATGACTTACATTGTAAAATGGAGGGAGTATCATATTTCATCTTCACTCTAGCTTTAGTTCAAAAGTTTTTGGCCCTAGTGGCATTTTGAAGAATCTCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 30.60% 0.02% 0.47% TATATTCATATTCATATTCCATATTCATATTGATTATTCTATATAGTC: 0.02%
All Indica  2759 98.30% 1.30% 0.04% 0.33% NA
All Japonica  1512 12.60% 86.80% 0.00% 0.60% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.50% 0.00% 0.34% NA
Indica II  465 98.70% 1.10% 0.00% 0.22% NA
Indica III  913 97.70% 2.00% 0.00% 0.33% NA
Indica Intermediate  786 98.20% 1.30% 0.13% 0.38% NA
Temperate Japonica  767 6.30% 93.40% 0.00% 0.39% NA
Tropical Japonica  504 22.60% 76.80% 0.00% 0.60% NA
Japonica Intermediate  241 11.60% 87.10% 0.00% 1.24% NA
VI/Aromatic  96 24.00% 75.00% 0.00% 1.04% NA
Intermediate  90 68.90% 26.70% 0.00% 3.33% TATATTCATATTCATATTCCATATTCATATTGATTATTCTATATAGTC: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0631211794 T -> C LOC_Os06g51510.1 upstream_gene_variant ; 402.0bp to feature; MODIFIER silent_mutation Average:76.594; most accessible tissue: Callus, score: 96.102 N N N N
vg0631211794 T -> C LOC_Os06g51520.1 upstream_gene_variant ; 609.0bp to feature; MODIFIER silent_mutation Average:76.594; most accessible tissue: Callus, score: 96.102 N N N N
vg0631211794 T -> C LOC_Os06g51510.2 upstream_gene_variant ; 402.0bp to feature; MODIFIER silent_mutation Average:76.594; most accessible tissue: Callus, score: 96.102 N N N N
vg0631211794 T -> C LOC_Os06g51520.4 upstream_gene_variant ; 609.0bp to feature; MODIFIER silent_mutation Average:76.594; most accessible tissue: Callus, score: 96.102 N N N N
vg0631211794 T -> C LOC_Os06g51520.2 upstream_gene_variant ; 609.0bp to feature; MODIFIER silent_mutation Average:76.594; most accessible tissue: Callus, score: 96.102 N N N N
vg0631211794 T -> C LOC_Os06g51520.5 upstream_gene_variant ; 609.0bp to feature; MODIFIER silent_mutation Average:76.594; most accessible tissue: Callus, score: 96.102 N N N N
vg0631211794 T -> C LOC_Os06g51510-LOC_Os06g51520 intergenic_region ; MODIFIER silent_mutation Average:76.594; most accessible tissue: Callus, score: 96.102 N N N N
vg0631211794 T -> TATATTCATATTCATATTCCATATTCATAT TGATTATTCTATATAGTC LOC_Os06g51510.1 upstream_gene_variant ; 403.0bp to feature; MODIFIER silent_mutation Average:76.594; most accessible tissue: Callus, score: 96.102 N N N N
vg0631211794 T -> TATATTCATATTCATATTCCATATTCATAT TGATTATTCTATATAGTC LOC_Os06g51520.1 upstream_gene_variant ; 608.0bp to feature; MODIFIER silent_mutation Average:76.594; most accessible tissue: Callus, score: 96.102 N N N N
vg0631211794 T -> TATATTCATATTCATATTCCATATTCATAT TGATTATTCTATATAGTC LOC_Os06g51510.2 upstream_gene_variant ; 403.0bp to feature; MODIFIER silent_mutation Average:76.594; most accessible tissue: Callus, score: 96.102 N N N N
vg0631211794 T -> TATATTCATATTCATATTCCATATTCATAT TGATTATTCTATATAGTC LOC_Os06g51520.4 upstream_gene_variant ; 608.0bp to feature; MODIFIER silent_mutation Average:76.594; most accessible tissue: Callus, score: 96.102 N N N N
vg0631211794 T -> TATATTCATATTCATATTCCATATTCATAT TGATTATTCTATATAGTC LOC_Os06g51520.2 upstream_gene_variant ; 608.0bp to feature; MODIFIER silent_mutation Average:76.594; most accessible tissue: Callus, score: 96.102 N N N N
vg0631211794 T -> TATATTCATATTCATATTCCATATTCATAT TGATTATTCTATATAGTC LOC_Os06g51520.5 upstream_gene_variant ; 608.0bp to feature; MODIFIER silent_mutation Average:76.594; most accessible tissue: Callus, score: 96.102 N N N N
vg0631211794 T -> TATATTCATATTCATATTCCATATTCATAT TGATTATTCTATATAGTC LOC_Os06g51510-LOC_Os06g51520 intergenic_region ; MODIFIER silent_mutation Average:76.594; most accessible tissue: Callus, score: 96.102 N N N N
vg0631211794 T -> DEL N N silent_mutation Average:76.594; most accessible tissue: Callus, score: 96.102 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0631211794 T C -0.01 -0.01 -0.01 -0.01 -0.01 -0.01
vg0631211794 T TATAT* -0.19 -0.12 -0.07 -0.1 -0.07 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0631211794 NA 2.34E-09 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 1.18E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 1.09E-77 mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 6.95E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 7.40E-62 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 1.61E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 5.61E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 6.21E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 3.11E-11 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 7.02E-06 mr1522 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 4.36E-45 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 2.31E-06 NA mr1712 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 1.14E-07 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 5.30E-06 2.96E-75 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 1.76E-09 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 3.97E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 1.51E-13 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 2.67E-13 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631211794 NA 3.00E-11 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251