\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0631079165:

Variant ID: vg0631079165 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 31079165
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCAACTTCAGCAGTCGGACTGATCGATCTACACCGGTCAGACCGACGGCACAGGTGCGGTCAGACCGGCAGATCAATCTCGGTCAGACCGATCTTCATC[G/A]
AATTCGATGGTAACTTTTATTTCCGCTAAAAGTTTTCAGTTTTTGGGTATACCAACCATTCACCCCCCCCCCTCTAGTTGGCTTAGTTGTTGTGATTCGA

Reverse complement sequence

TCGAATCACAACAACTAAGCCAACTAGAGGGGGGGGGGTGAATGGTTGGTATACCCAAAAACTGAAAACTTTTAGCGGAAATAAAAGTTACCATCGAATT[C/T]
GATGAAGATCGGTCTGACCGAGATTGATCTGCCGGTCTGACCGCACCTGTGCCGTCGGTCTGACCGGTGTAGATCGATCAGTCCGACTGCTGAAGTTGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 5.10% 0.13% 0.00% NA
All Indica  2759 98.30% 1.70% 0.00% 0.00% NA
All Japonica  1512 99.70% 0.20% 0.13% 0.00% NA
Aus  269 33.80% 65.40% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 96.90% 3.10% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.90% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.40% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 10.40% 2.08% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0631079165 G -> A LOC_Os06g51320.1 upstream_gene_variant ; 3581.0bp to feature; MODIFIER silent_mutation Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0631079165 G -> A LOC_Os06g51320.2 upstream_gene_variant ; 3587.0bp to feature; MODIFIER silent_mutation Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0631079165 G -> A LOC_Os06g51320.3 upstream_gene_variant ; 3587.0bp to feature; MODIFIER silent_mutation Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0631079165 G -> A LOC_Os06g51310.1 downstream_gene_variant ; 1684.0bp to feature; MODIFIER silent_mutation Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0631079165 G -> A LOC_Os06g51330.1 downstream_gene_variant ; 3941.0bp to feature; MODIFIER silent_mutation Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0631079165 G -> A LOC_Os06g51310.2 downstream_gene_variant ; 1684.0bp to feature; MODIFIER silent_mutation Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0631079165 G -> A LOC_Os06g51330.2 downstream_gene_variant ; 3941.0bp to feature; MODIFIER silent_mutation Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0631079165 G -> A LOC_Os06g51310-LOC_Os06g51320 intergenic_region ; MODIFIER silent_mutation Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0631079165 NA 8.59E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631079165 NA 2.83E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631079165 NA 1.32E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631079165 NA 2.52E-12 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631079165 NA 2.82E-12 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631079165 NA 1.19E-08 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631079165 NA 1.97E-20 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631079165 NA 3.42E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631079165 3.30E-06 NA mr1817_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631079165 NA 1.72E-16 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251