\
| Variant ID: vg0631079165 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 31079165 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGCAACTTCAGCAGTCGGACTGATCGATCTACACCGGTCAGACCGACGGCACAGGTGCGGTCAGACCGGCAGATCAATCTCGGTCAGACCGATCTTCATC[G/A]
AATTCGATGGTAACTTTTATTTCCGCTAAAAGTTTTCAGTTTTTGGGTATACCAACCATTCACCCCCCCCCCTCTAGTTGGCTTAGTTGTTGTGATTCGA
TCGAATCACAACAACTAAGCCAACTAGAGGGGGGGGGGTGAATGGTTGGTATACCCAAAAACTGAAAACTTTTAGCGGAAATAAAAGTTACCATCGAATT[C/T]
GATGAAGATCGGTCTGACCGAGATTGATCTGCCGGTCTGACCGCACCTGTGCCGTCGGTCTGACCGGTGTAGATCGATCAGTCCGACTGCTGAAGTTGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.80% | 5.10% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.13% | 0.00% | NA |
| Aus | 269 | 33.80% | 65.40% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 10.40% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0631079165 | G -> A | LOC_Os06g51320.1 | upstream_gene_variant ; 3581.0bp to feature; MODIFIER | silent_mutation | Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0631079165 | G -> A | LOC_Os06g51320.2 | upstream_gene_variant ; 3587.0bp to feature; MODIFIER | silent_mutation | Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0631079165 | G -> A | LOC_Os06g51320.3 | upstream_gene_variant ; 3587.0bp to feature; MODIFIER | silent_mutation | Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0631079165 | G -> A | LOC_Os06g51310.1 | downstream_gene_variant ; 1684.0bp to feature; MODIFIER | silent_mutation | Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0631079165 | G -> A | LOC_Os06g51330.1 | downstream_gene_variant ; 3941.0bp to feature; MODIFIER | silent_mutation | Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0631079165 | G -> A | LOC_Os06g51310.2 | downstream_gene_variant ; 1684.0bp to feature; MODIFIER | silent_mutation | Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0631079165 | G -> A | LOC_Os06g51330.2 | downstream_gene_variant ; 3941.0bp to feature; MODIFIER | silent_mutation | Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0631079165 | G -> A | LOC_Os06g51310-LOC_Os06g51320 | intergenic_region ; MODIFIER | silent_mutation | Average:51.239; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0631079165 | NA | 8.59E-07 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631079165 | NA | 2.83E-09 | mr1608 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631079165 | NA | 1.32E-06 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631079165 | NA | 2.52E-12 | mr1897 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631079165 | NA | 2.82E-12 | mr1927 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631079165 | NA | 1.19E-08 | mr1939 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631079165 | NA | 1.97E-20 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631079165 | NA | 3.42E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631079165 | 3.30E-06 | NA | mr1817_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631079165 | NA | 1.72E-16 | mr1927_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |