Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0631078961:

Variant ID: vg0631078961 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 31078961
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTTTGTAAACACAGAGAGAATCAATAAAGTCGTTATCCACTTTAAGAGTTCTTTGATTTGTGTTTCACCGGGTTTCAGCGGTCTAACCGGTGGCGCACC[A/G]
GCGGTCAGACCGCCGGCATCGTGGCGGTCAGACCGGCGAGCACACGGCGGTCAGACCGGCGAGCACACGGCGGTCAGACCGGCGGCGGCGACAGGCGCAG

Reverse complement sequence

CTGCGCCTGTCGCCGCCGCCGGTCTGACCGCCGTGTGCTCGCCGGTCTGACCGCCGTGTGCTCGCCGGTCTGACCGCCACGATGCCGGCGGTCTGACCGC[T/C]
GGTGCGCCACCGGTTAGACCGCTGAAACCCGGTGAAACACAAATCAAAGAACTCTTAAAGTGGATAACGACTTTATTGATTCTCTCTGTGTTTACAAAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.30%	31.20%	1.95%	1.57%	NA
All Indica	2759	92.80%	1.70%	3.01%	2.50%	NA
All Japonica	1512	12.50%	87.40%	0.07%	0.00%	NA
Aus	269	97.80%	0.00%	1.12%	1.12%	NA
Indica I	595	92.30%	0.70%	4.03%	3.03%	NA
Indica II	465	91.80%	3.20%	3.01%	1.94%	NA
Indica III	913	95.00%	1.40%	1.42%	2.19%	NA
Indica Intermediate	786	91.30%	1.80%	4.07%	2.80%	NA
Temperate Japonica	767	6.30%	93.70%	0.00%	0.00%	NA
Tropical Japonica	504	22.20%	77.60%	0.20%	0.00%	NA
Japonica Intermediate	241	12.00%	88.00%	0.00%	0.00%	NA
VI/Aromatic	96	19.80%	77.10%	2.08%	1.04%	NA
Intermediate	90	61.10%	34.40%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0631078961	A -> G	LOC_Os06g51320.1	upstream_gene_variant ; 3785.0bp to feature; MODIFIER	silent_mutation	Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0631078961	A -> G	LOC_Os06g51320.2	upstream_gene_variant ; 3791.0bp to feature; MODIFIER	silent_mutation	Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0631078961	A -> G	LOC_Os06g51320.3	upstream_gene_variant ; 3791.0bp to feature; MODIFIER	silent_mutation	Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0631078961	A -> G	LOC_Os06g51310.1	downstream_gene_variant ; 1480.0bp to feature; MODIFIER	silent_mutation	Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0631078961	A -> G	LOC_Os06g51330.1	downstream_gene_variant ; 4145.0bp to feature; MODIFIER	silent_mutation	Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0631078961	A -> G	LOC_Os06g51310.2	downstream_gene_variant ; 1480.0bp to feature; MODIFIER	silent_mutation	Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0631078961	A -> G	LOC_Os06g51330.2	downstream_gene_variant ; 4145.0bp to feature; MODIFIER	silent_mutation	Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0631078961	A -> G	LOC_Os06g51310-LOC_Os06g51320	intergenic_region ; MODIFIER	silent_mutation	Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0631078961	A -> DEL	N	N	silent_mutation	Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0631078961	NA	1.59E-09	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	2.01E-10	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	6.28E-84	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	6.34E-10	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	2.23E-06	1.80E-67	mr1019	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	3.97E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	5.63E-11	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	7.64E-70	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	1.86E-69	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	8.86E-12	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	1.29E-06	mr1522	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	7.25E-35	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	4.42E-47	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	1.17E-07	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	3.82E-79	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	4.53E-73	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	3.34E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	2.50E-13	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	6.71E-78	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	1.39E-13	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	1.53E-51	mr1261_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	5.31E-13	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	6.97E-14	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	2.72E-11	mr1520_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961	NA	7.36E-74	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251