\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0631078961:

Variant ID: vg0631078961 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 31078961
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTTGTAAACACAGAGAGAATCAATAAAGTCGTTATCCACTTTAAGAGTTCTTTGATTTGTGTTTCACCGGGTTTCAGCGGTCTAACCGGTGGCGCACC[A/G]
GCGGTCAGACCGCCGGCATCGTGGCGGTCAGACCGGCGAGCACACGGCGGTCAGACCGGCGAGCACACGGCGGTCAGACCGGCGGCGGCGACAGGCGCAG

Reverse complement sequence

CTGCGCCTGTCGCCGCCGCCGGTCTGACCGCCGTGTGCTCGCCGGTCTGACCGCCGTGTGCTCGCCGGTCTGACCGCCACGATGCCGGCGGTCTGACCGC[T/C]
GGTGCGCCACCGGTTAGACCGCTGAAACCCGGTGAAACACAAATCAAAGAACTCTTAAAGTGGATAACGACTTTATTGATTCTCTCTGTGTTTACAAAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 31.20% 1.95% 1.57% NA
All Indica  2759 92.80% 1.70% 3.01% 2.50% NA
All Japonica  1512 12.50% 87.40% 0.07% 0.00% NA
Aus  269 97.80% 0.00% 1.12% 1.12% NA
Indica I  595 92.30% 0.70% 4.03% 3.03% NA
Indica II  465 91.80% 3.20% 3.01% 1.94% NA
Indica III  913 95.00% 1.40% 1.42% 2.19% NA
Indica Intermediate  786 91.30% 1.80% 4.07% 2.80% NA
Temperate Japonica  767 6.30% 93.70% 0.00% 0.00% NA
Tropical Japonica  504 22.20% 77.60% 0.20% 0.00% NA
Japonica Intermediate  241 12.00% 88.00% 0.00% 0.00% NA
VI/Aromatic  96 19.80% 77.10% 2.08% 1.04% NA
Intermediate  90 61.10% 34.40% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0631078961 A -> G LOC_Os06g51320.1 upstream_gene_variant ; 3785.0bp to feature; MODIFIER silent_mutation Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0631078961 A -> G LOC_Os06g51320.2 upstream_gene_variant ; 3791.0bp to feature; MODIFIER silent_mutation Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0631078961 A -> G LOC_Os06g51320.3 upstream_gene_variant ; 3791.0bp to feature; MODIFIER silent_mutation Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0631078961 A -> G LOC_Os06g51310.1 downstream_gene_variant ; 1480.0bp to feature; MODIFIER silent_mutation Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0631078961 A -> G LOC_Os06g51330.1 downstream_gene_variant ; 4145.0bp to feature; MODIFIER silent_mutation Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0631078961 A -> G LOC_Os06g51310.2 downstream_gene_variant ; 1480.0bp to feature; MODIFIER silent_mutation Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0631078961 A -> G LOC_Os06g51330.2 downstream_gene_variant ; 4145.0bp to feature; MODIFIER silent_mutation Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0631078961 A -> G LOC_Os06g51310-LOC_Os06g51320 intergenic_region ; MODIFIER silent_mutation Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0631078961 A -> DEL N N silent_mutation Average:57.935; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0631078961 NA 1.59E-09 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 2.01E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 6.28E-84 mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 6.34E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 2.23E-06 1.80E-67 mr1019 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 3.97E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 5.63E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 7.64E-70 mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 1.86E-69 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 8.86E-12 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 1.29E-06 mr1522 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 7.25E-35 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 4.42E-47 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 1.17E-07 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 3.82E-79 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 4.53E-73 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 3.34E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 2.50E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 6.71E-78 mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 1.39E-13 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 1.53E-51 mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 5.31E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 6.97E-14 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 2.72E-11 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078961 NA 7.36E-74 mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251