\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0631078445:

Variant ID: vg0631078445 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 31078445
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


CGTATGTAATACTGTTGTTTGCTACTCATGAGTCAAGTTGGAGATAGCTTGATCTCGGAATATGGTTTCTTTGTTTGTTCTATGTGTAGGTGACTCGATG[C/T]
CTCGGGAGAGTATTTGCGGTGATGGACCAGGAGTCGACTTGGGGATAAGACGACGTCCGTGGTGGTCAGAGATCATGCGGGATACTTAGGCTAGAGTTGA

Reverse complement sequence

TCAACTCTAGCCTAAGTATCCCGCATGATCTCTGACCACCACGGACGTCGTCTTATCCCCAAGTCGACTCCTGGTCCATCACCGCAAATACTCTCCCGAG[G/A]
CATCGAGTCACCTACACATAGAACAAACAAAGAAACCATATTCCGAGATCAAGCTATCTCCAACTTGACTCATGAGTAGCAAACAACAGTATTACATACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 4.20% 1.29% 0.00% NA
All Indica  2759 90.80% 7.10% 2.03% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 92.30% 2.20% 5.55% 0.00% NA
Indica II  465 88.40% 9.70% 1.94% 0.00% NA
Indica III  913 88.40% 11.60% 0.00% 0.00% NA
Indica Intermediate  786 94.00% 4.20% 1.78% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 1.10% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0631078445 C -> T LOC_Os06g51320.1 upstream_gene_variant ; 4301.0bp to feature; MODIFIER silent_mutation Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0631078445 C -> T LOC_Os06g51320.2 upstream_gene_variant ; 4307.0bp to feature; MODIFIER silent_mutation Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0631078445 C -> T LOC_Os06g51320.3 upstream_gene_variant ; 4307.0bp to feature; MODIFIER silent_mutation Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0631078445 C -> T LOC_Os06g51310.1 downstream_gene_variant ; 964.0bp to feature; MODIFIER silent_mutation Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0631078445 C -> T LOC_Os06g51330.1 downstream_gene_variant ; 4661.0bp to feature; MODIFIER silent_mutation Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0631078445 C -> T LOC_Os06g51310.2 downstream_gene_variant ; 964.0bp to feature; MODIFIER silent_mutation Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0631078445 C -> T LOC_Os06g51330.2 downstream_gene_variant ; 4661.0bp to feature; MODIFIER silent_mutation Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0631078445 C -> T LOC_Os06g51310-LOC_Os06g51320 intergenic_region ; MODIFIER silent_mutation Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0631078445 NA 1.32E-11 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078445 NA 4.50E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078445 2.98E-06 2.60E-07 mr1019_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078445 NA 1.76E-09 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078445 7.57E-11 1.55E-16 mr1055_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078445 8.48E-06 NA mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078445 NA 3.45E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251