| Variant ID: vg0630922941 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 30922941 |
| Reference Allele: T | Alternative Allele: C,TC |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TACCTAATTAAAACATAAGTAAGGCTTTCGATTTTGTTTGTGTCTATCTGGTTTTTCGCCTTTGTTTTCTAGGCCGAACAATTTTTTCGCCTTTTTTTTC[T/C,TC]
AGGCCGATTGATTTTTTTTTCTGCGTGCACGCGATAAGTCTATATCTAATTAAAAAATAAGTAAGGCCAGATTCCATTTTGATTTTGGTCCATATGATTT
AAATCATATGGACCAAAATCAAAATGGAATCTGGCCTTACTTATTTTTTAATTAGATATAGACTTATCGCGTGCACGCAGAAAAAAAAATCAATCGGCCT[A/G,GA]
GAAAAAAAAGGCGAAAAAATTGTTCGGCCTAGAAAACAAAGGCGAAAAACCAGATAGACACAAACAAAATCGAAAGCCTTACTTATGTTTTAATTAGGTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.50% | 28.20% | 0.28% | 0.00% | TC: 0.02% |
| All Indica | 2759 | 99.20% | 0.50% | 0.25% | 0.00% | TC: 0.04% |
| All Japonica | 1512 | 17.10% | 82.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 95.20% | 3.30% | 1.49% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.30% | 0.11% | 0.00% | TC: 0.11% |
| Indica Intermediate | 786 | 98.90% | 0.80% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 32.30% | 67.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 16.60% | 83.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 59.40% | 40.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0630922941 | T -> C | LOC_Os06g51110.1 | upstream_gene_variant ; 4079.0bp to feature; MODIFIER | silent_mutation | Average:42.933; most accessible tissue: Callus, score: 79.003 | N | N | N | N |
| vg0630922941 | T -> C | LOC_Os06g51130.1 | upstream_gene_variant ; 1256.0bp to feature; MODIFIER | silent_mutation | Average:42.933; most accessible tissue: Callus, score: 79.003 | N | N | N | N |
| vg0630922941 | T -> C | LOC_Os06g51110.2 | upstream_gene_variant ; 4821.0bp to feature; MODIFIER | silent_mutation | Average:42.933; most accessible tissue: Callus, score: 79.003 | N | N | N | N |
| vg0630922941 | T -> C | LOC_Os06g51120.1 | downstream_gene_variant ; 1851.0bp to feature; MODIFIER | silent_mutation | Average:42.933; most accessible tissue: Callus, score: 79.003 | N | N | N | N |
| vg0630922941 | T -> C | LOC_Os06g51120-LOC_Os06g51130 | intergenic_region ; MODIFIER | silent_mutation | Average:42.933; most accessible tissue: Callus, score: 79.003 | N | N | N | N |
| vg0630922941 | T -> TC | LOC_Os06g51110.1 | upstream_gene_variant ; 4080.0bp to feature; MODIFIER | silent_mutation | Average:42.933; most accessible tissue: Callus, score: 79.003 | N | N | N | N |
| vg0630922941 | T -> TC | LOC_Os06g51130.1 | upstream_gene_variant ; 1255.0bp to feature; MODIFIER | silent_mutation | Average:42.933; most accessible tissue: Callus, score: 79.003 | N | N | N | N |
| vg0630922941 | T -> TC | LOC_Os06g51110.2 | upstream_gene_variant ; 4822.0bp to feature; MODIFIER | silent_mutation | Average:42.933; most accessible tissue: Callus, score: 79.003 | N | N | N | N |
| vg0630922941 | T -> TC | LOC_Os06g51120.1 | downstream_gene_variant ; 1852.0bp to feature; MODIFIER | silent_mutation | Average:42.933; most accessible tissue: Callus, score: 79.003 | N | N | N | N |
| vg0630922941 | T -> TC | LOC_Os06g51120-LOC_Os06g51130 | intergenic_region ; MODIFIER | silent_mutation | Average:42.933; most accessible tissue: Callus, score: 79.003 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0630922941 | NA | 4.42E-10 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630922941 | NA | 2.34E-56 | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630922941 | NA | 1.00E-15 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630922941 | NA | 5.63E-10 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630922941 | NA | 1.87E-10 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630922941 | NA | 3.41E-11 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630922941 | NA | 1.54E-06 | mr1522 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630922941 | NA | 5.22E-35 | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630922941 | NA | 8.69E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630922941 | 5.41E-06 | NA | mr1712 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630922941 | NA | 4.99E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630922941 | NA | 1.63E-13 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630922941 | NA | 4.61E-69 | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630922941 | NA | 1.91E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630922941 | NA | 2.27E-13 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630922941 | NA | 1.77E-13 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |