\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630922941:

Variant ID: vg0630922941 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 30922941
Reference Allele: TAlternative Allele: C,TC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACCTAATTAAAACATAAGTAAGGCTTTCGATTTTGTTTGTGTCTATCTGGTTTTTCGCCTTTGTTTTCTAGGCCGAACAATTTTTTCGCCTTTTTTTTC[T/C,TC]
AGGCCGATTGATTTTTTTTTCTGCGTGCACGCGATAAGTCTATATCTAATTAAAAAATAAGTAAGGCCAGATTCCATTTTGATTTTGGTCCATATGATTT

Reverse complement sequence

AAATCATATGGACCAAAATCAAAATGGAATCTGGCCTTACTTATTTTTTAATTAGATATAGACTTATCGCGTGCACGCAGAAAAAAAAATCAATCGGCCT[A/G,GA]
GAAAAAAAAGGCGAAAAAATTGTTCGGCCTAGAAAACAAAGGCGAAAAACCAGATAGACACAAACAAAATCGAAAGCCTTACTTATGTTTTAATTAGGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.50% 28.20% 0.28% 0.00% TC: 0.02%
All Indica  2759 99.20% 0.50% 0.25% 0.00% TC: 0.04%
All Japonica  1512 17.10% 82.80% 0.07% 0.00% NA
Aus  269 95.20% 3.30% 1.49% 0.00% NA
Indica I  595 99.20% 0.30% 0.50% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.50% 0.30% 0.11% 0.00% TC: 0.11%
Indica Intermediate  786 98.90% 0.80% 0.38% 0.00% NA
Temperate Japonica  767 7.30% 92.70% 0.00% 0.00% NA
Tropical Japonica  504 32.30% 67.70% 0.00% 0.00% NA
Japonica Intermediate  241 16.60% 83.00% 0.41% 0.00% NA
VI/Aromatic  96 59.40% 40.60% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0630922941 T -> C LOC_Os06g51110.1 upstream_gene_variant ; 4079.0bp to feature; MODIFIER silent_mutation Average:42.933; most accessible tissue: Callus, score: 79.003 N N N N
vg0630922941 T -> C LOC_Os06g51130.1 upstream_gene_variant ; 1256.0bp to feature; MODIFIER silent_mutation Average:42.933; most accessible tissue: Callus, score: 79.003 N N N N
vg0630922941 T -> C LOC_Os06g51110.2 upstream_gene_variant ; 4821.0bp to feature; MODIFIER silent_mutation Average:42.933; most accessible tissue: Callus, score: 79.003 N N N N
vg0630922941 T -> C LOC_Os06g51120.1 downstream_gene_variant ; 1851.0bp to feature; MODIFIER silent_mutation Average:42.933; most accessible tissue: Callus, score: 79.003 N N N N
vg0630922941 T -> C LOC_Os06g51120-LOC_Os06g51130 intergenic_region ; MODIFIER silent_mutation Average:42.933; most accessible tissue: Callus, score: 79.003 N N N N
vg0630922941 T -> TC LOC_Os06g51110.1 upstream_gene_variant ; 4080.0bp to feature; MODIFIER silent_mutation Average:42.933; most accessible tissue: Callus, score: 79.003 N N N N
vg0630922941 T -> TC LOC_Os06g51130.1 upstream_gene_variant ; 1255.0bp to feature; MODIFIER silent_mutation Average:42.933; most accessible tissue: Callus, score: 79.003 N N N N
vg0630922941 T -> TC LOC_Os06g51110.2 upstream_gene_variant ; 4822.0bp to feature; MODIFIER silent_mutation Average:42.933; most accessible tissue: Callus, score: 79.003 N N N N
vg0630922941 T -> TC LOC_Os06g51120.1 downstream_gene_variant ; 1852.0bp to feature; MODIFIER silent_mutation Average:42.933; most accessible tissue: Callus, score: 79.003 N N N N
vg0630922941 T -> TC LOC_Os06g51120-LOC_Os06g51130 intergenic_region ; MODIFIER silent_mutation Average:42.933; most accessible tissue: Callus, score: 79.003 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0630922941 NA 4.42E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630922941 NA 2.34E-56 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630922941 NA 1.00E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630922941 NA 5.63E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630922941 NA 1.87E-10 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630922941 NA 3.41E-11 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630922941 NA 1.54E-06 mr1522 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630922941 NA 5.22E-35 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630922941 NA 8.69E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630922941 5.41E-06 NA mr1712 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630922941 NA 4.99E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630922941 NA 1.63E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630922941 NA 4.61E-69 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630922941 NA 1.91E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630922941 NA 2.27E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630922941 NA 1.77E-13 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251