RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0630899696:

Variant ID: vg0630899696 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 30899696
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, C: 0.04, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

GGGTCCTTGGCATTCGTCCTTTATCTTTAGAATAATTTTTCAGAACATGCCGTTCCGATTTATGCATGGAAAATGCATGCCCACATCAATTCTGTGTGAA[C/A]
ATCAAAGAAACTGTAGGTAGCCTAAGGAAACATTTTATGCTAATAGGAAAGGATTGAAATAATGTGCTGCACAGGAAATTTGAACTCGATTCCAAAGTGA

Reverse complement sequence

TCACTTTGGAATCGAGTTCAAATTTCCTGTGCAGCACATTATTTCAATCCTTTCCTATTAGCATAAAATGTTTCCTTAGGCTACCTACAGTTTCTTTGAT[G/T]
TTCACACAGAATTGATGTGGGCATGCATTTTCCATGCATAAATCGGAACGGCATGTTCTGAAAAATTATTCTAAAGATAAAGGACGAATGCCAAGGACCC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.00%	13.00%	0.02%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.00%	NA
All Japonica	1512	60.40%	39.50%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	30.10%	69.80%	0.13%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	76.80%	23.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0630899696	C -> A	LOC_Os06g51084.1	intron_variant ; MODIFIER	silent_mutation	Average:50.856; most accessible tissue: Callus, score: 82.758	N	N	N	N
vg0630899696	C -> A	LOC_Os06g51084.3	intron_variant ; MODIFIER	silent_mutation	Average:50.856; most accessible tissue: Callus, score: 82.758	N	N	N	N
vg0630899696	C -> A	LOC_Os06g51084.7	intron_variant ; MODIFIER	silent_mutation	Average:50.856; most accessible tissue: Callus, score: 82.758	N	N	N	N
vg0630899696	C -> A	LOC_Os06g51084.5	intron_variant ; MODIFIER	silent_mutation	Average:50.856; most accessible tissue: Callus, score: 82.758	N	N	N	N
vg0630899696	C -> A	LOC_Os06g51084.2	intron_variant ; MODIFIER	silent_mutation	Average:50.856; most accessible tissue: Callus, score: 82.758	N	N	N	N
vg0630899696	C -> A	LOC_Os06g51084.6	intron_variant ; MODIFIER	silent_mutation	Average:50.856; most accessible tissue: Callus, score: 82.758	N	N	N	N
vg0630899696	C -> A	LOC_Os06g51084.8	intron_variant ; MODIFIER	silent_mutation	Average:50.856; most accessible tissue: Callus, score: 82.758	N	N	N	N
vg0630899696	C -> A	LOC_Os06g51084.4	intron_variant ; MODIFIER	silent_mutation	Average:50.856; most accessible tissue: Callus, score: 82.758	N	N	N	N

Showing 1 to 8 of 8 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0630899696	NA	1.17E-09	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0630899696	NA	1.71E-17	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0630899696	NA	1.58E-11	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0630899696	NA	1.11E-08	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630899696	NA	3.38E-14	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630899696	NA	2.38E-09	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630899696	NA	1.01E-13	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630899696	NA	7.66E-08	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630899696	NA	5.34E-15	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630899696	NA	2.36E-09	mr1056	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 33 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0630899696:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact