\
| Variant ID: vg0630884821 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 30884821 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGGAGTAGAGAATCTACATCAATTTTCTCGTGAAACTATGTGTAGACCTTCCCCATTCAAATAACAATAATCTTCACCAACAAAAAGTCATGTAACCTA[G/A]
TGGTTACAGTGACCTGAGTAGTACCTCAAAGTTCTGAGTTTAAATCTTCTATGGAGCGAATTTTAGATTGAGTTAGATTGAGTTGTTTACGGGGCTAAGT
ACTTAGCCCCGTAAACAACTCAATCTAACTCAATCTAAAATTCGCTCCATAGAAGATTTAAACTCAGAACTTTGAGGTACTACTCAGGTCACTGTAACCA[C/T]
TAGGTTACATGACTTTTTGTTGGTGAAGATTATTGTTATTTGAATGGGGAAGGTCTACACATAGTTTCACGAGAAAATTGATGTAGATTCTCTACTCCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.50% | 4.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 85.70% | 14.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.90% | 24.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 68.80% | 30.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0630884821 | G -> A | LOC_Os06g51050.1 | upstream_gene_variant ; 2394.0bp to feature; MODIFIER | silent_mutation | Average:36.875; most accessible tissue: Callus, score: 77.415 | N | N | N | N |
| vg0630884821 | G -> A | LOC_Os06g51029-LOC_Os06g51050 | intergenic_region ; MODIFIER | silent_mutation | Average:36.875; most accessible tissue: Callus, score: 77.415 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0630884821 | 1.36E-06 | NA | mr1252 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630884821 | NA | 3.25E-07 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630884821 | NA | 3.74E-06 | mr1293 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630884821 | NA | 3.08E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630884821 | NA | 4.11E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630884821 | NA | 9.14E-06 | mr1221_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |