\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630863292:

Variant ID: vg0630863292 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 30863292
Reference Allele: CAlternative Allele: CT,T
Primary Allele: CTSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.11, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TATTACTATTATTTTAATTTTCAAATATAAGCTGTGGACTTGGACCCATAGTAGGAGTACAACATAAAATTTGGGTTTTGGCTGTGTTAATAGATTCCAA[C/CT,T]
TTTTTTCTTCAAATTTTTAACTTTTTCGTCACATCAAATGTTTGGACACATGCATAAAGTATTAAATGTGGAAGAAAAAAAATTGCACAGTTTACATGTA

Reverse complement sequence

TACATGTAAACTGTGCAATTTTTTTTCTTCCACATTTAATACTTTATGCATGTGTCCAAACATTTGATGTGACGAAAAAGTTAAAAATTTGAAGAAAAAA[G/AG,A]
TTGGAATCTATTAACACAGCCAAAACCCAAATTTTATGTTGTACTCCTACTATGGGTCCAAGTCCACAGCTTATATTTGAAAATTAAAATAATAGTAATA

Allele Frequencies:

Populations Population SizeFrequency of CT(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 32.50% 0.08% 0.28% T: 10.35%
All Indica  2759 83.10% 14.60% 0.04% 0.47% T: 1.78%
All Japonica  1512 12.70% 70.60% 0.00% 0.00% T: 16.73%
Aus  269 50.90% 0.40% 0.37% 0.00% T: 48.33%
Indica I  595 91.90% 7.90% 0.17% 0.00% NA
Indica II  465 86.90% 12.00% 0.00% 0.65% T: 0.43%
Indica III  913 72.90% 22.90% 0.00% 0.88% T: 3.29%
Indica Intermediate  786 85.90% 11.70% 0.00% 0.25% T: 2.16%
Temperate Japonica  767 6.60% 92.70% 0.00% 0.00% T: 0.65%
Tropical Japonica  504 23.00% 31.30% 0.00% 0.00% T: 45.63%
Japonica Intermediate  241 10.40% 82.20% 0.00% 0.00% T: 7.47%
VI/Aromatic  96 9.40% 44.80% 0.00% 0.00% T: 45.83%
Intermediate  90 61.10% 22.20% 2.22% 0.00% T: 14.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0630863292 C -> T LOC_Os06g51000.1 upstream_gene_variant ; 2721.0bp to feature; MODIFIER silent_mutation Average:39.581; most accessible tissue: Callus, score: 77.823 N N N N
vg0630863292 C -> T LOC_Os06g50990.1 downstream_gene_variant ; 3829.0bp to feature; MODIFIER silent_mutation Average:39.581; most accessible tissue: Callus, score: 77.823 N N N N
vg0630863292 C -> T LOC_Os06g50990-LOC_Os06g51000 intergenic_region ; MODIFIER silent_mutation Average:39.581; most accessible tissue: Callus, score: 77.823 N N N N
vg0630863292 C -> DEL N N silent_mutation Average:39.581; most accessible tissue: Callus, score: 77.823 N N N N
vg0630863292 C -> CT LOC_Os06g51000.1 upstream_gene_variant ; 2720.0bp to feature; MODIFIER silent_mutation Average:39.581; most accessible tissue: Callus, score: 77.823 N N N N
vg0630863292 C -> CT LOC_Os06g50990.1 downstream_gene_variant ; 3830.0bp to feature; MODIFIER silent_mutation Average:39.581; most accessible tissue: Callus, score: 77.823 N N N N
vg0630863292 C -> CT LOC_Os06g50990-LOC_Os06g51000 intergenic_region ; MODIFIER silent_mutation Average:39.581; most accessible tissue: Callus, score: 77.823 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0630863292 NA 3.24E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630863292 8.92E-06 2.04E-08 mr1762_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630863292 6.44E-06 NA mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251