\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630826682:

Variant ID: vg0630826682 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 30826682
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTAGCGGAATTTAAATTATAACCATAAATGTACTTCATATATCAATAATAACATAAAACCATACTTTAAATTTACAAGTTTAAACAACGTACTTAATTAG[A/T]
ACTCCCTCCGTTCCAAAATATAAGGCACAACCACCCTTAACCCAAAGACTAAGAAATAATTATTATCATCATATAGTTTGGATCAAAGTGGTTGTGCCTT

Reverse complement sequence

AAGGCACAACCACTTTGATCCAAACTATATGATGATAATAATTATTTCTTAGTCTTTGGGTTAAGGGTGGTTGTGCCTTATATTTTGGAACGGAGGGAGT[T/A]
CTAATTAAGTACGTTGTTTAAACTTGTAAATTTAAAGTATGGTTTTATGTTATTATTGATATATGAAGTACATTTATGGTTATAATTTAAATTCCGCTAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.70% 18.20% 0.02% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 45.90% 54.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 11.20% 88.80% 0.00% 0.00% NA
Tropical Japonica  504 96.40% 3.60% 0.00% 0.00% NA
Japonica Intermediate  241 50.60% 49.40% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 26.00% 1.04% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0630826682 A -> T LOC_Os06g50930.1 upstream_gene_variant ; 568.0bp to feature; MODIFIER silent_mutation Average:69.305; most accessible tissue: Callus, score: 94.078 N N N N
vg0630826682 A -> T LOC_Os06g50930.2 upstream_gene_variant ; 568.0bp to feature; MODIFIER silent_mutation Average:69.305; most accessible tissue: Callus, score: 94.078 N N N N
vg0630826682 A -> T LOC_Os06g50920.1 downstream_gene_variant ; 2797.0bp to feature; MODIFIER silent_mutation Average:69.305; most accessible tissue: Callus, score: 94.078 N N N N
vg0630826682 A -> T LOC_Os06g50940.1 downstream_gene_variant ; 1589.0bp to feature; MODIFIER silent_mutation Average:69.305; most accessible tissue: Callus, score: 94.078 N N N N
vg0630826682 A -> T LOC_Os06g50930-LOC_Os06g50940 intergenic_region ; MODIFIER silent_mutation Average:69.305; most accessible tissue: Callus, score: 94.078 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0630826682 NA 2.26E-21 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 1.72E-17 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 6.77E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 5.65E-10 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 2.04E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 5.30E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 2.76E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 9.45E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 1.31E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 2.23E-15 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 9.81E-08 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 7.82E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 4.76E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 8.00E-18 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 5.62E-06 9.32E-09 mr1884 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 7.04E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 4.55E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 3.76E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 8.92E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682 NA 2.86E-09 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251