Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630826682:

Variant ID: vg0630826682 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 30826682
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTAGCGGAATTTAAATTATAACCATAAATGTACTTCATATATCAATAATAACATAAAACCATACTTTAAATTTACAAGTTTAAACAACGTACTTAATTAG[A/T]
ACTCCCTCCGTTCCAAAATATAAGGCACAACCACCCTTAACCCAAAGACTAAGAAATAATTATTATCATCATATAGTTTGGATCAAAGTGGTTGTGCCTT

Reverse complement sequence

AAGGCACAACCACTTTGATCCAAACTATATGATGATAATAATTATTTCTTAGTCTTTGGGTTAAGGGTGGTTGTGCCTTATATTTTGGAACGGAGGGAGT[T/A]
CTAATTAAGTACGTTGTTTAAACTTGTAAATTTAAAGTATGGTTTTATGTTATTATTGATATATGAAGTACATTTATGGTTATAATTTAAATTCCGCTAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.70%	18.20%	0.02%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	45.90%	54.10%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	11.20%	88.80%	0.00%	0.00%	NA
Tropical Japonica	504	96.40%	3.60%	0.00%	0.00%	NA
Japonica Intermediate	241	50.60%	49.40%	0.00%	0.00%	NA
VI/Aromatic	96	72.90%	26.00%	1.04%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0630826682	A -> T	LOC_Os06g50930.1	upstream_gene_variant ; 568.0bp to feature; MODIFIER	silent_mutation	Average:69.305; most accessible tissue: Callus, score: 94.078	N	N	N	N
vg0630826682	A -> T	LOC_Os06g50930.2	upstream_gene_variant ; 568.0bp to feature; MODIFIER	silent_mutation	Average:69.305; most accessible tissue: Callus, score: 94.078	N	N	N	N
vg0630826682	A -> T	LOC_Os06g50920.1	downstream_gene_variant ; 2797.0bp to feature; MODIFIER	silent_mutation	Average:69.305; most accessible tissue: Callus, score: 94.078	N	N	N	N
vg0630826682	A -> T	LOC_Os06g50940.1	downstream_gene_variant ; 1589.0bp to feature; MODIFIER	silent_mutation	Average:69.305; most accessible tissue: Callus, score: 94.078	N	N	N	N
vg0630826682	A -> T	LOC_Os06g50930-LOC_Os06g50940	intergenic_region ; MODIFIER	silent_mutation	Average:69.305; most accessible tissue: Callus, score: 94.078	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0630826682	NA	2.26E-21	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	1.72E-17	mr1308	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	6.77E-08	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	5.65E-10	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	2.04E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	5.30E-06	mr1414	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	2.76E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	9.45E-08	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	1.31E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	2.23E-15	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	9.81E-08	mr1606	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	7.82E-06	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	4.76E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	8.00E-18	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	5.62E-06	9.32E-09	mr1884	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	7.04E-18	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	4.55E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	3.76E-06	mr1346_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	8.92E-06	mr1686_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630826682	NA	2.86E-09	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251