\
| Variant ID: vg0630809492 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 30809492 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 241. )
CTGAAGATTCACATCACTGGAATGAAGCATTTTCTTGTCAATACTGTTGAGAAGCCGAACAAAATCATTCTTCAAAAACTCAGGAAGGTTATCGTTGCCT[G/A]
TCAAAATTCTTGCGATATTCTGAATAGTTGGTGAAATTTTTGCCATCCTGCAATTAAAATCTCATTATAACTAAGATCAAAATTATTTTTTTTCTGGGGA
TCCCCAGAAAAAAAATAATTTTGATCTTAGTTATAATGAGATTTTAATTGCAGGATGGCAAAAATTTCACCAACTATTCAGAATATCGCAAGAATTTTGA[C/T]
AGGCAACGATAACCTTCCTGAGTTTTTGAAGAATGATTTTGTTCGGCTTCTCAACAGTATTGACAAGAAAATGCTTCATTCCAGTGATGTGAATCTTCAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 43.90% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 38.30% | 61.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 87.10% | 12.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 51.70% | 48.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 42.40% | 57.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 34.50% | 65.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 93.50% | 6.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 76.20% | 23.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 53.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0630809492 | G -> A | LOC_Os06g50910.1 | missense_variant ; p.Thr1050Ile; MODERATE | nonsynonymous_codon ; T1050I | Average:37.479; most accessible tissue: Callus, score: 72.819 | benign |
0.695 |
DELETERIOUS | 0.03 |
| vg0630809492 | G -> A | LOC_Os06g50910.3 | missense_variant ; p.Thr1050Ile; MODERATE | nonsynonymous_codon ; T1050I | Average:37.479; most accessible tissue: Callus, score: 72.819 | benign |
0.695 |
DELETERIOUS | 0.03 |
| vg0630809492 | G -> A | LOC_Os06g50910.2 | missense_variant ; p.Thr1050Ile; MODERATE | nonsynonymous_codon ; T1050I | Average:37.479; most accessible tissue: Callus, score: 72.819 | benign |
0.695 |
DELETERIOUS | 0.03 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0630809492 | NA | 5.23E-10 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630809492 | NA | 1.85E-10 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630809492 | NA | 4.38E-10 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630809492 | NA | 6.67E-11 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630809492 | NA | 1.24E-11 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630809492 | NA | 5.74E-07 | mr1522 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630809492 | 1.66E-06 | 4.77E-06 | mr1704 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630809492 | NA | 8.49E-08 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630809492 | NA | 3.86E-14 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630809492 | NA | 1.33E-13 | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630809492 | NA | 3.33E-13 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630809492 | NA | 4.91E-14 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630809492 | NA | 2.56E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |