\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630798684:

Variant ID: vg0630798684 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 30798684
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTTATAGGGCTTACTCGGGGAGTTGCTAGCTGGTGTAGCTTCTCCTAGAATCAGAAGTTTCCTCAAACAGTTCAGCTTTTAGTTCAGATTTTGAGAAA[C/T]
AATAGTTATATAATCCAGAAAAATGAATAAGCCACAAGCTGAAAAATACAGCTTTTTCCAGATCCTCATAAACTAGTTACCAACCAACTACTTCTTAAAA

Reverse complement sequence

TTTTAAGAAGTAGTTGGTTGGTAACTAGTTTATGAGGATCTGGAAAAAGCTGTATTTTTCAGCTTGTGGCTTATTCATTTTTCTGGATTATATAACTATT[G/A]
TTTCTCAAAATCTGAACTAAAAGCTGAACTGTTTGAGGAAACTTCTGATTCTAGGAGAAGCTACACCAGCTAGCAACTCCCCGAGTAAGCCCTATAACTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.10% 34.50% 0.13% 0.25% NA
All Indica  2759 63.90% 35.50% 0.18% 0.40% NA
All Japonica  1512 71.80% 28.20% 0.00% 0.00% NA
Aus  269 53.50% 46.50% 0.00% 0.00% NA
Indica I  595 70.10% 29.60% 0.34% 0.00% NA
Indica II  465 69.50% 29.90% 0.00% 0.65% NA
Indica III  913 55.30% 43.80% 0.33% 0.55% NA
Indica Intermediate  786 66.00% 33.60% 0.00% 0.38% NA
Temperate Japonica  767 95.40% 4.60% 0.00% 0.00% NA
Tropical Japonica  504 31.20% 68.80% 0.00% 0.00% NA
Japonica Intermediate  241 81.30% 18.70% 0.00% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 63.30% 34.40% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0630798684 C -> T LOC_Os06g50900.1 upstream_gene_variant ; 721.0bp to feature; MODIFIER silent_mutation Average:72.636; most accessible tissue: Callus, score: 92.646 N N N N
vg0630798684 C -> T LOC_Os06g50910.3 downstream_gene_variant ; 3708.0bp to feature; MODIFIER silent_mutation Average:72.636; most accessible tissue: Callus, score: 92.646 N N N N
vg0630798684 C -> T LOC_Os06g50910.1 intron_variant ; MODIFIER silent_mutation Average:72.636; most accessible tissue: Callus, score: 92.646 N N N N
vg0630798684 C -> DEL N N silent_mutation Average:72.636; most accessible tissue: Callus, score: 92.646 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0630798684 C T -0.01 0.01 0.01 0.0 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0630798684 NA 2.31E-15 mr1016 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 2.43E-15 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 8.03E-14 mr1018 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 3.47E-10 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 4.02E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 7.02E-16 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 3.06E-14 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 1.13E-11 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 2.17E-14 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 1.10E-14 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 1.99E-13 mr1019_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 2.12E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 3.72E-18 mr1055_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 2.07E-18 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 2.99E-18 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 2.83E-10 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 9.61E-18 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 6.02E-19 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630798684 NA 1.01E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251