\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630786990:

Variant ID: vg0630786990 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 30786990
Reference Allele: TAlternative Allele: C,TTC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AATTAATACAAGGTCCACTTGTGTCTCTCACAGAGTTTCTTAGTTCTTGAGTCCAATCCGGCTATAAGTTAATTTACAGCCCGCTTCTTCTCTCTCCTCT[T/C,TTC]
CTCTCCATTTACCTCAGCATTCAACGGGTTTATAGGCTACTATTATACTTGCCCTATCTATTTAGGAATTGAGGGAGCAGTAGCCAGCAGTAAAGCAGCG

Reverse complement sequence

CGCTGCTTTACTGCTGGCTACTGCTCCCTCAATTCCTAAATAGATAGGGCAAGTATAATAGTAGCCTATAAACCCGTTGAATGCTGAGGTAAATGGAGAG[A/G,GAA]
AGAGGAGAGAGAAGAAGCGGGCTGTAAATTAACTTATAGCCGGATTGGACTCAAGAACTAAGAAACTCTGTGAGAGACACAAGTGGACCTTGTATTAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.20% 0.59% 0.00% TTC: 0.04%
All Indica  2759 76.30% 22.70% 1.01% 0.00% NA
All Japonica  1512 35.60% 64.40% 0.00% 0.00% NA
Aus  269 52.80% 47.20% 0.00% 0.00% NA
Indica I  595 74.60% 22.40% 3.03% 0.00% NA
Indica II  465 86.00% 13.50% 0.43% 0.00% NA
Indica III  913 77.10% 22.80% 0.11% 0.00% NA
Indica Intermediate  786 70.90% 28.20% 0.89% 0.00% NA
Temperate Japonica  767 8.50% 91.50% 0.00% 0.00% NA
Tropical Japonica  504 73.20% 26.80% 0.00% 0.00% NA
Japonica Intermediate  241 43.60% 56.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 0.00% TTC: 2.08%
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0630786990 T -> C LOC_Os06g50890.1 downstream_gene_variant ; 3351.0bp to feature; MODIFIER silent_mutation Average:87.037; most accessible tissue: Minghui63 panicle, score: 98.119 N N N N
vg0630786990 T -> C LOC_Os06g50890-LOC_Os06g50910 intergenic_region ; MODIFIER silent_mutation Average:87.037; most accessible tissue: Minghui63 panicle, score: 98.119 N N N N
vg0630786990 T -> TTC LOC_Os06g50890.1 downstream_gene_variant ; 3352.0bp to feature; MODIFIER silent_mutation Average:87.037; most accessible tissue: Minghui63 panicle, score: 98.119 N N N N
vg0630786990 T -> TTC LOC_Os06g50890-LOC_Os06g50910 intergenic_region ; MODIFIER silent_mutation Average:87.037; most accessible tissue: Minghui63 panicle, score: 98.119 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0630786990 T C 0.01 -0.01 -0.01 -0.01 0.0 0.0
vg0630786990 T TTC 0.07 -0.1 -0.07 -0.11 -0.07 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0630786990 5.19E-07 9.39E-08 mr1188 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630786990 NA 3.21E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630786990 NA 4.83E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251