Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630658313:

Variant ID: vg0630658313 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 30658313
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTCATTACTTTTTCTGTTCTAAAATGTTGCTACATGATACATGATTGCGCGTCACTTTCTAATACAACAAATCTGTATAAGTGCATGTGCAATCGTGTA[T/C]
AGAGTTAGTATTATTAGAAAAATAGAGAATAAAACATCAACCCTTATTATACTGAGAGTAAAGTTTAAAAATCAATCAATTGGACAATAGTTAATTATTT

Reverse complement sequence

AAATAATTAACTATTGTCCAATTGATTGATTTTTAAACTTTACTCTCAGTATAATAAGGGTTGATGTTTTATTCTCTATTTTTCTAATAATACTAACTCT[A/G]
TACACGATTGCACATGCACTTATACAGATTTGTTGTATTAGAAAGTGACGCGCAATCATGTATCATGTAGCAACATTTTAGAACAGAAAAAGTAATGAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.90%	16.50%	5.82%	33.75%	NA
All Indica	2759	66.90%	0.50%	6.74%	25.88%	NA
All Japonica	1512	10.60%	50.10%	4.76%	34.52%	NA
Aus	269	7.40%	0.00%	2.97%	89.59%	NA
Indica I	595	86.10%	0.70%	9.08%	4.20%	NA
Indica II	465	69.70%	0.40%	1.51%	28.39%	NA
Indica III	913	51.20%	0.10%	8.11%	40.64%	NA
Indica Intermediate	786	69.10%	0.80%	6.49%	23.66%	NA
Temperate Japonica	767	5.70%	83.20%	2.48%	8.60%	NA
Tropical Japonica	504	18.30%	3.60%	6.35%	71.83%	NA
Japonica Intermediate	241	10.00%	42.30%	8.71%	39.00%	NA
VI/Aromatic	96	5.20%	0.00%	4.17%	90.62%	NA
Intermediate	90	47.80%	12.20%	5.56%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0630658313	T -> C	LOC_Os06g50650.1	downstream_gene_variant ; 54.0bp to feature; MODIFIER	silent_mutation	Average:20.664; most accessible tissue: Zhenshan97 root, score: 66.982	N	N	N	N
vg0630658313	T -> C	LOC_Os06g50630-LOC_Os06g50650	intergenic_region ; MODIFIER	silent_mutation	Average:20.664; most accessible tissue: Zhenshan97 root, score: 66.982	N	N	N	N
vg0630658313	T -> DEL	N	N	silent_mutation	Average:20.664; most accessible tissue: Zhenshan97 root, score: 66.982	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0630658313	NA	4.92E-18	mr1308	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	1.11E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	6.40E-09	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	4.92E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	8.30E-10	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	1.03E-08	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	3.21E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	3.66E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	6.24E-07	mr1606	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	9.45E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	9.56E-07	5.01E-17	mr1653	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	1.00E-06	NA	mr1718	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	3.68E-10	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	8.15E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	5.54E-16	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	8.63E-14	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	2.41E-12	mr1879	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	2.26E-15	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	1.44E-24	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	6.62E-07	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	1.62E-06	mr1346_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	1.00E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	2.99E-09	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	2.00E-17	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	4.77E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	5.76E-06	mr1686_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	1.34E-06	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	6.06E-06	mr1792_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313	NA	3.41E-12	mr1879_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251