\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630658313:

Variant ID: vg0630658313 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 30658313
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTCATTACTTTTTCTGTTCTAAAATGTTGCTACATGATACATGATTGCGCGTCACTTTCTAATACAACAAATCTGTATAAGTGCATGTGCAATCGTGTA[T/C]
AGAGTTAGTATTATTAGAAAAATAGAGAATAAAACATCAACCCTTATTATACTGAGAGTAAAGTTTAAAAATCAATCAATTGGACAATAGTTAATTATTT

Reverse complement sequence

AAATAATTAACTATTGTCCAATTGATTGATTTTTAAACTTTACTCTCAGTATAATAAGGGTTGATGTTTTATTCTCTATTTTTCTAATAATACTAACTCT[A/G]
TACACGATTGCACATGCACTTATACAGATTTGTTGTATTAGAAAGTGACGCGCAATCATGTATCATGTAGCAACATTTTAGAACAGAAAAAGTAATGAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.90% 16.50% 5.82% 33.75% NA
All Indica  2759 66.90% 0.50% 6.74% 25.88% NA
All Japonica  1512 10.60% 50.10% 4.76% 34.52% NA
Aus  269 7.40% 0.00% 2.97% 89.59% NA
Indica I  595 86.10% 0.70% 9.08% 4.20% NA
Indica II  465 69.70% 0.40% 1.51% 28.39% NA
Indica III  913 51.20% 0.10% 8.11% 40.64% NA
Indica Intermediate  786 69.10% 0.80% 6.49% 23.66% NA
Temperate Japonica  767 5.70% 83.20% 2.48% 8.60% NA
Tropical Japonica  504 18.30% 3.60% 6.35% 71.83% NA
Japonica Intermediate  241 10.00% 42.30% 8.71% 39.00% NA
VI/Aromatic  96 5.20% 0.00% 4.17% 90.62% NA
Intermediate  90 47.80% 12.20% 5.56% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0630658313 T -> C LOC_Os06g50650.1 downstream_gene_variant ; 54.0bp to feature; MODIFIER silent_mutation Average:20.664; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N
vg0630658313 T -> C LOC_Os06g50630-LOC_Os06g50650 intergenic_region ; MODIFIER silent_mutation Average:20.664; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N
vg0630658313 T -> DEL N N silent_mutation Average:20.664; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0630658313 NA 4.92E-18 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 1.11E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 6.40E-09 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 4.92E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 8.30E-10 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 1.03E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 3.21E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 3.66E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 6.24E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 9.45E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 9.56E-07 5.01E-17 mr1653 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 1.00E-06 NA mr1718 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 3.68E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 8.15E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 5.54E-16 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 8.63E-14 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 2.41E-12 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 2.26E-15 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 1.44E-24 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 6.62E-07 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 1.62E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 1.00E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 2.99E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 2.00E-17 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 4.77E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 5.76E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 1.34E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 6.06E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630658313 NA 3.41E-12 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251