\
| Variant ID: vg0630642055 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 30642055 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.12, others allele: 0.00, population size: 85. )
GCTGTGCTCGCGGTTAATGAGCGCCGAGACCTGTACTACTCTTGACTAGACTTATAGATTTTAATACTGCTTAGAGTAGTTATGAGAGACATGTGAACCT[C/T]
GCCCATAGAGTGGGAAGGTCAGTATAGTAGAGTTAATAAGACGAAATATGAGGGTAAACCGAACTAAGCAGGGCTTGGAGAGGTGGATGAAACCTAAATA
TATTTAGGTTTCATCCACCTCTCCAAGCCCTGCTTAGTTCGGTTTACCCTCATATTTCGTCTTATTAACTCTACTATACTGACCTTCCCACTCTATGGGC[G/A]
AGGTTCACATGTCTCTCATAACTACTCTAAGCAGTATTAAAATCTATAAGTCTAGTCAAGAGTAGTACAGGTCTCGGCGCTCATTAACCGCGAGCACAGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.10% | 17.10% | 4.49% | 41.26% | NA |
| All Indica | 2759 | 55.10% | 0.90% | 7.18% | 36.79% | NA |
| All Japonica | 1512 | 12.90% | 51.00% | 0.33% | 35.78% | NA |
| Aus | 269 | 1.10% | 0.00% | 0.74% | 98.14% | NA |
| Indica I | 595 | 80.30% | 1.00% | 14.29% | 4.37% | NA |
| Indica II | 465 | 57.60% | 1.70% | 5.38% | 35.27% | NA |
| Indica III | 913 | 36.40% | 0.30% | 1.53% | 61.77% | NA |
| Indica Intermediate | 786 | 56.20% | 1.10% | 9.41% | 33.21% | NA |
| Temperate Japonica | 767 | 5.70% | 83.10% | 0.39% | 10.82% | NA |
| Tropical Japonica | 504 | 24.00% | 4.20% | 0.00% | 71.83% | NA |
| Japonica Intermediate | 241 | 12.40% | 46.90% | 0.83% | 39.83% | NA |
| VI/Aromatic | 96 | 3.10% | 0.00% | 2.08% | 94.79% | NA |
| Intermediate | 90 | 37.80% | 13.30% | 5.56% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0630642055 | C -> T | LOC_Os06g50620.1 | upstream_gene_variant ; 2302.0bp to feature; MODIFIER | silent_mutation | Average:29.869; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg0630642055 | C -> T | LOC_Os06g50630.1 | downstream_gene_variant ; 3030.0bp to feature; MODIFIER | silent_mutation | Average:29.869; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg0630642055 | C -> T | LOC_Os06g50620-LOC_Os06g50630 | intergenic_region ; MODIFIER | silent_mutation | Average:29.869; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg0630642055 | C -> DEL | N | N | silent_mutation | Average:29.869; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0630642055 | NA | 1.19E-17 | mr1308 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 1.23E-07 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 9.16E-09 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 2.10E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 1.09E-10 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 3.68E-08 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 1.06E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 1.58E-11 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 2.40E-06 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 1.97E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 5.79E-09 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 6.56E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | 1.12E-06 | 1.57E-17 | mr1653 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 4.95E-06 | mr1653 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 1.19E-08 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 2.30E-13 | mr1879 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 7.01E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 1.59E-07 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 6.10E-06 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 6.70E-09 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 3.35E-09 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630642055 | NA | 2.61E-11 | mr1879_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |