Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630586442:

Variant ID: vg0630586442 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 30586442
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.07, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

AAATATAAATTGATCATTCCAGTGAAGCATCCTACTATGCTATTCTCAGATGTACACTACAAAAGTTCAATCGCGACTCCACTTCAAACTGAAATTATCA[T/C]
TGAAGAATGAAAAGCAAATGCTCTCTTTAGCTATCTTTTCTGAAATAGAAATGTGTCCTTTGATTGAATTATAATCTTATGTAACATTTTGAAACCTCCA

Reverse complement sequence

TGGAGGTTTCAAAATGTTACATAAGATTATAATTCAATCAAAGGACACATTTCTATTTCAGAAAAGATAGCTAAAGAGAGCATTTGCTTTTCATTCTTCA[A/G]
TGATAATTTCAGTTTGAAGTGGAGTCGCGATTGAACTTTTGTAGTGTACATCTGAGAATAGCATAGTAGGATGCTTCACTGGAATGATCAATTTATATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.20%	25.00%	0.59%	0.17%	NA
All Indica	2759	95.70%	4.30%	0.07%	0.00%	NA
All Japonica	1512	34.70%	63.10%	1.65%	0.53%	NA
Aus	269	89.60%	10.40%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	98.90%	0.90%	0.22%	0.00%	NA
Indica III	913	91.60%	8.40%	0.00%	0.00%	NA
Indica Intermediate	786	95.70%	4.20%	0.13%	0.00%	NA
Temperate Japonica	767	12.80%	82.90%	3.26%	1.04%	NA
Tropical Japonica	504	64.50%	35.50%	0.00%	0.00%	NA
Japonica Intermediate	241	42.30%	57.70%	0.00%	0.00%	NA
VI/Aromatic	96	36.50%	63.50%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0630586442	T -> C	LOC_Os06g50520.1	upstream_gene_variant ; 2720.0bp to feature; MODIFIER	silent_mutation	Average:22.477; most accessible tissue: Minghui63 young leaf, score: 28.65	N	N	N	N
vg0630586442	T -> C	LOC_Os06g50520.2	upstream_gene_variant ; 2720.0bp to feature; MODIFIER	silent_mutation	Average:22.477; most accessible tissue: Minghui63 young leaf, score: 28.65	N	N	N	N
vg0630586442	T -> C	LOC_Os06g50510.1	downstream_gene_variant ; 2847.0bp to feature; MODIFIER	silent_mutation	Average:22.477; most accessible tissue: Minghui63 young leaf, score: 28.65	N	N	N	N
vg0630586442	T -> C	LOC_Os06g50510-LOC_Os06g50520	intergenic_region ; MODIFIER	silent_mutation	Average:22.477; most accessible tissue: Minghui63 young leaf, score: 28.65	N	N	N	N
vg0630586442	T -> DEL	N	N	silent_mutation	Average:22.477; most accessible tissue: Minghui63 young leaf, score: 28.65	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0630586442	1.95E-08	NA	Grain_width	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0630586442	NA	4.80E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251