\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630586442:

Variant ID: vg0630586442 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 30586442
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.07, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


AAATATAAATTGATCATTCCAGTGAAGCATCCTACTATGCTATTCTCAGATGTACACTACAAAAGTTCAATCGCGACTCCACTTCAAACTGAAATTATCA[T/C]
TGAAGAATGAAAAGCAAATGCTCTCTTTAGCTATCTTTTCTGAAATAGAAATGTGTCCTTTGATTGAATTATAATCTTATGTAACATTTTGAAACCTCCA

Reverse complement sequence

TGGAGGTTTCAAAATGTTACATAAGATTATAATTCAATCAAAGGACACATTTCTATTTCAGAAAAGATAGCTAAAGAGAGCATTTGCTTTTCATTCTTCA[A/G]
TGATAATTTCAGTTTGAAGTGGAGTCGCGATTGAACTTTTGTAGTGTACATCTGAGAATAGCATAGTAGGATGCTTCACTGGAATGATCAATTTATATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 25.00% 0.59% 0.17% NA
All Indica  2759 95.70% 4.30% 0.07% 0.00% NA
All Japonica  1512 34.70% 63.10% 1.65% 0.53% NA
Aus  269 89.60% 10.40% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 91.60% 8.40% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 4.20% 0.13% 0.00% NA
Temperate Japonica  767 12.80% 82.90% 3.26% 1.04% NA
Tropical Japonica  504 64.50% 35.50% 0.00% 0.00% NA
Japonica Intermediate  241 42.30% 57.70% 0.00% 0.00% NA
VI/Aromatic  96 36.50% 63.50% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0630586442 T -> C LOC_Os06g50520.1 upstream_gene_variant ; 2720.0bp to feature; MODIFIER silent_mutation Average:22.477; most accessible tissue: Minghui63 young leaf, score: 28.65 N N N N
vg0630586442 T -> C LOC_Os06g50520.2 upstream_gene_variant ; 2720.0bp to feature; MODIFIER silent_mutation Average:22.477; most accessible tissue: Minghui63 young leaf, score: 28.65 N N N N
vg0630586442 T -> C LOC_Os06g50510.1 downstream_gene_variant ; 2847.0bp to feature; MODIFIER silent_mutation Average:22.477; most accessible tissue: Minghui63 young leaf, score: 28.65 N N N N
vg0630586442 T -> C LOC_Os06g50510-LOC_Os06g50520 intergenic_region ; MODIFIER silent_mutation Average:22.477; most accessible tissue: Minghui63 young leaf, score: 28.65 N N N N
vg0630586442 T -> DEL N N silent_mutation Average:22.477; most accessible tissue: Minghui63 young leaf, score: 28.65 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0630586442 1.95E-08 NA Grain_width All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0630586442 NA 4.80E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251