Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630585467:

Variant ID: vg0630585467 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 30585467
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

CGCGCGGGTGCTAGCACATCTGCGCGTGGCGTTCCGTCCCTGTACGTGTGGATACCGGTAGAGGTGCCGCTGGTTTGCGGTGCTGATCAGCATGGGAATA[C/T]
GGCGAGGAGAACGCACGAGGAGGAGAAGGTCGAGCCGGTGCGATCGACTACTTCCTCTACATCGACGCGCGCTACTTCGCGAGAATTCTTTCGACTTCTT

Reverse complement sequence

AAGAAGTCGAAAGAATTCTCGCGAAGTAGCGCGCGTCGATGTAGAGGAAGTAGTCGATCGCACCGGCTCGACCTTCTCCTCCTCGTGCGTTCTCCTCGCC[G/A]
TATTCCCATGCTGATCAGCACCGCAAACCAGCGGCACCTCTACCGGTATCCACACGTACAGGGACGGAACGCCACGCGCAGATGTGCTAGCACCCGCGCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.60%	12.40%	0.04%	0.00%	NA
All Indica	2759	88.10%	11.80%	0.07%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	14.10%	85.90%	0.00%	0.00%	NA
Indica I	595	96.30%	3.70%	0.00%	0.00%	NA
Indica II	465	90.30%	9.70%	0.00%	0.00%	NA
Indica III	913	81.10%	18.80%	0.11%	0.00%	NA
Indica Intermediate	786	88.90%	10.90%	0.13%	0.00%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0630585467	C -> T	LOC_Os06g50520.1	upstream_gene_variant ; 3695.0bp to feature; MODIFIER	silent_mutation	Average:64.458; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0630585467	C -> T	LOC_Os06g50520.2	upstream_gene_variant ; 3695.0bp to feature; MODIFIER	silent_mutation	Average:64.458; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0630585467	C -> T	LOC_Os06g50510.1	downstream_gene_variant ; 1872.0bp to feature; MODIFIER	silent_mutation	Average:64.458; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0630585467	C -> T	LOC_Os06g50510-LOC_Os06g50520	intergenic_region ; MODIFIER	silent_mutation	Average:64.458; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0630585467	NA	7.56E-06	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630585467	3.07E-06	3.74E-07	mr1043_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630585467	NA	3.16E-06	mr1291_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630585467	9.82E-06	2.76E-06	mr1677_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630585467	4.35E-07	4.35E-07	mr1912_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251