\
| Variant ID: vg0630443303 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 30443303 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 119. )
TGGCAGCGATATGGGCCAAGAGGAGGTTAGAGCCATGTGTCCAATGAAATGGTGACTTTATTATTATCTCACATCATGTATTTCTAAGATCATTTCATAT[A/G]
TAAATATATATAATTATTATATACATGTTTAGTTTACAAGTCATGCGGAATATTTAAATGTACTGTGCATTGTCTTATGTATGCAATAAAATGACTACAA
TTGTAGTCATTTTATTGCATACATAAGACAATGCACAGTACATTTAAATATTCCGCATGACTTGTAAACTAAACATGTATATAATAATTATATATATTTA[T/C]
ATATGAAATGATCTTAGAAATACATGATGTGAGATAATAATAAAGTCACCATTTCATTGGACACATGGCTCTAACCTCCTCTTGGCCCATATCGCTGCCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.40% | 2.40% | 19.97% | 34.26% | NA |
| All Indica | 2759 | 28.60% | 3.70% | 30.52% | 37.22% | NA |
| All Japonica | 1512 | 63.30% | 0.40% | 3.37% | 32.94% | NA |
| Aus | 269 | 88.50% | 0.70% | 9.29% | 1.49% | NA |
| Indica I | 595 | 46.60% | 1.20% | 13.95% | 38.32% | NA |
| Indica II | 465 | 6.70% | 2.40% | 29.03% | 61.94% | NA |
| Indica III | 913 | 27.40% | 6.90% | 43.81% | 21.91% | NA |
| Indica Intermediate | 786 | 29.30% | 2.70% | 28.50% | 39.57% | NA |
| Temperate Japonica | 767 | 93.50% | 0.10% | 0.39% | 6.00% | NA |
| Tropical Japonica | 504 | 19.00% | 1.00% | 8.33% | 71.63% | NA |
| Japonica Intermediate | 241 | 59.80% | 0.00% | 2.49% | 37.76% | NA |
| VI/Aromatic | 96 | 36.50% | 0.00% | 5.21% | 58.33% | NA |
| Intermediate | 90 | 36.70% | 2.20% | 23.33% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0630443303 | A -> G | LOC_Os06g50290.1 | downstream_gene_variant ; 71.0bp to feature; MODIFIER | silent_mutation | Average:8.893; most accessible tissue: Callus, score: 43.968 | N | N | N | N |
| vg0630443303 | A -> G | LOC_Os06g50300.1 | downstream_gene_variant ; 1108.0bp to feature; MODIFIER | silent_mutation | Average:8.893; most accessible tissue: Callus, score: 43.968 | N | N | N | N |
| vg0630443303 | A -> G | LOC_Os06g50290-LOC_Os06g50300 | intergenic_region ; MODIFIER | silent_mutation | Average:8.893; most accessible tissue: Callus, score: 43.968 | N | N | N | N |
| vg0630443303 | A -> DEL | N | N | silent_mutation | Average:8.893; most accessible tissue: Callus, score: 43.968 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0630443303 | NA | 5.63E-07 | mr1064_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630443303 | 3.30E-06 | NA | mr1124_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630443303 | 6.20E-06 | 1.23E-06 | mr1312_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630443303 | 3.93E-07 | 2.49E-08 | mr1663_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630443303 | 1.01E-06 | NA | mr1665_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630443303 | 5.95E-06 | NA | mr1687_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630443303 | NA | 6.37E-08 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |