Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0630442371:

Variant ID: vg0630442371 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 30442371
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

CACCTCTCCAAAAGTGCACCGCTGCTATTCGAATGCTAGGATATGGCACACCAGCGGACGCACTAGATGAGGTACTCAAGATTGCAGCGAGCACTTCTTT[G/A]
GAATGTTTGGGAAAATTTGCCGTAGGAATAATTGAATGTTTTGGTAGCGAGTACTTGCGTCCTCCGACAAGTGATGAACTAGAAAAAATTTTACAAGAGA

Reverse complement sequence

TCTCTTGTAAAATTTTTTCTAGTTCATCACTTGTCGGAGGACGCAAGTACTCGCTACCAAAACATTCAATTATTCCTACGGCAAATTTTCCCAAACATTC[C/T]
AAAGAAGTGCTCGCTGCAATCTTGAGTACCTCATCTAGTGCGTCCGCTGGTGTGCCATATCCTAGCATTCGAATAGCAGCGGTGCACTTTTGGAGAGGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.00%	0.10%	5.67%	47.23%	NA
All Indica	2759	33.20%	0.10%	6.78%	59.84%	NA
All Japonica	1512	64.20%	0.20%	4.83%	30.75%	NA
Aus	269	95.20%	0.00%	0.00%	4.83%	NA
Indica I	595	48.40%	0.50%	6.55%	44.54%	NA
Indica II	465	13.10%	0.00%	7.53%	79.35%	NA
Indica III	913	32.00%	0.00%	6.57%	61.45%	NA
Indica Intermediate	786	35.10%	0.10%	6.74%	58.02%	NA
Temperate Japonica	767	94.10%	0.10%	0.39%	5.35%	NA
Tropical Japonica	504	20.80%	0.20%	12.50%	66.47%	NA
Japonica Intermediate	241	59.80%	0.40%	2.90%	36.93%	NA
VI/Aromatic	96	38.50%	0.00%	1.04%	60.42%	NA
Intermediate	90	42.20%	0.00%	7.78%	50.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0630442371	G -> A	LOC_Os06g50290.1	synonymous_variant ; p.Leu615Leu; LOW	synonymous_codon	Average:9.999; most accessible tissue: Callus, score: 20.768	N	N	N	N
vg0630442371	G -> DEL	LOC_Os06g50290.1	N	frameshift_variant	Average:9.999; most accessible tissue: Callus, score: 20.768	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0630442371	1.85E-06	1.85E-06	mr1590	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	NA	3.29E-06	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	3.60E-06	3.60E-06	mr1891	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	NA	9.04E-07	mr1964	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	3.37E-06	3.37E-06	mr1159_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	4.69E-06	8.41E-07	mr1312_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	1.29E-06	1.29E-06	mr1312_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	8.13E-06	8.14E-06	mr1313_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	NA	4.14E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	NA	2.20E-06	mr1397_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	4.15E-06	4.15E-06	mr1453_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	3.43E-07	2.17E-08	mr1663_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	2.09E-06	2.09E-06	mr1663_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	4.67E-06	NA	mr1665_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	1.55E-06	7.02E-07	mr1665_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	9.07E-06	9.07E-06	mr1687_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	NA	5.48E-06	mr1812_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	NA	4.17E-06	mr1816_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	8.81E-06	8.81E-06	mr1832_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630442371	3.55E-06	3.55E-06	mr1847_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251