\
| Variant ID: vg0630442371 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 30442371 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )
CACCTCTCCAAAAGTGCACCGCTGCTATTCGAATGCTAGGATATGGCACACCAGCGGACGCACTAGATGAGGTACTCAAGATTGCAGCGAGCACTTCTTT[G/A]
GAATGTTTGGGAAAATTTGCCGTAGGAATAATTGAATGTTTTGGTAGCGAGTACTTGCGTCCTCCGACAAGTGATGAACTAGAAAAAATTTTACAAGAGA
TCTCTTGTAAAATTTTTTCTAGTTCATCACTTGTCGGAGGACGCAAGTACTCGCTACCAAAACATTCAATTATTCCTACGGCAAATTTTCCCAAACATTC[C/T]
AAAGAAGTGCTCGCTGCAATCTTGAGTACCTCATCTAGTGCGTCCGCTGGTGTGCCATATCCTAGCATTCGAATAGCAGCGGTGCACTTTTGGAGAGGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.00% | 0.10% | 5.67% | 47.23% | NA |
| All Indica | 2759 | 33.20% | 0.10% | 6.78% | 59.84% | NA |
| All Japonica | 1512 | 64.20% | 0.20% | 4.83% | 30.75% | NA |
| Aus | 269 | 95.20% | 0.00% | 0.00% | 4.83% | NA |
| Indica I | 595 | 48.40% | 0.50% | 6.55% | 44.54% | NA |
| Indica II | 465 | 13.10% | 0.00% | 7.53% | 79.35% | NA |
| Indica III | 913 | 32.00% | 0.00% | 6.57% | 61.45% | NA |
| Indica Intermediate | 786 | 35.10% | 0.10% | 6.74% | 58.02% | NA |
| Temperate Japonica | 767 | 94.10% | 0.10% | 0.39% | 5.35% | NA |
| Tropical Japonica | 504 | 20.80% | 0.20% | 12.50% | 66.47% | NA |
| Japonica Intermediate | 241 | 59.80% | 0.40% | 2.90% | 36.93% | NA |
| VI/Aromatic | 96 | 38.50% | 0.00% | 1.04% | 60.42% | NA |
| Intermediate | 90 | 42.20% | 0.00% | 7.78% | 50.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0630442371 | G -> A | LOC_Os06g50290.1 | synonymous_variant ; p.Leu615Leu; LOW | synonymous_codon | Average:9.999; most accessible tissue: Callus, score: 20.768 | N | N | N | N |
| vg0630442371 | G -> DEL | LOC_Os06g50290.1 | N | frameshift_variant | Average:9.999; most accessible tissue: Callus, score: 20.768 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0630442371 | 1.85E-06 | 1.85E-06 | mr1590 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | NA | 3.29E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | 3.60E-06 | 3.60E-06 | mr1891 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | NA | 9.04E-07 | mr1964 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | 3.37E-06 | 3.37E-06 | mr1159_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | 4.69E-06 | 8.41E-07 | mr1312_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | 1.29E-06 | 1.29E-06 | mr1312_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | 8.13E-06 | 8.14E-06 | mr1313_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | NA | 4.14E-06 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | NA | 2.20E-06 | mr1397_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | 4.15E-06 | 4.15E-06 | mr1453_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | 3.43E-07 | 2.17E-08 | mr1663_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | 2.09E-06 | 2.09E-06 | mr1663_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | 4.67E-06 | NA | mr1665_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | 1.55E-06 | 7.02E-07 | mr1665_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | 9.07E-06 | 9.07E-06 | mr1687_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | NA | 5.48E-06 | mr1812_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | NA | 4.17E-06 | mr1816_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | 8.81E-06 | 8.81E-06 | mr1832_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630442371 | 3.55E-06 | 3.55E-06 | mr1847_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |