\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630366621:

Variant ID: vg0630366621 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 30366621
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGATCGCGCTCGAAGGTTGCAACGGCGAGGAAGAAACCGATCGGCTGGTCGGAACGGAATGCGGAGGTGGCGCCGGCGAGGCGAGGCGACGAGAGGCGG[C/A]
AGTTGGTGGGGAGTTAGAGGCTCGCCATGACCGTCTCGACCATCCGCCACGTAGGAGTTCGTTGTTGCTTATATTGGGGGTGCAAAATTAATTAAAGCAC

Reverse complement sequence

GTGCTTTAATTAATTTTGCACCCCCAATATAAGCAACAACGAACTCCTACGTGGCGGATGGTCGAGACGGTCATGGCGAGCCTCTAACTCCCCACCAACT[G/T]
CCGCCTCTCGTCGCCTCGCCTCGCCGGCGCCACCTCCGCATTCCGTTCCGACCAGCCGATCGGTTTCTTCCTCGCCGTTGCAACCTTCGAGCGCGATCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.50% 15.40% 0.15% 0.00% NA
All Indica  2759 93.10% 6.70% 0.14% 0.00% NA
All Japonica  1512 69.20% 30.70% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 75.50% 23.90% 0.67% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 2.70% 0.00% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 35.70% 64.30% 0.00% 0.00% NA
Japonica Intermediate  241 48.10% 51.50% 0.41% 0.00% NA
VI/Aromatic  96 33.30% 65.60% 1.04% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0630366621 C -> A LOC_Os06g50140.1 5_prime_UTR_variant ; 265.0bp to feature; MODIFIER silent_mutation Average:81.864; most accessible tissue: Zhenshan97 flag leaf, score: 88.445 N N N N
vg0630366621 C -> A LOC_Os06g50146.1 upstream_gene_variant ; 729.0bp to feature; MODIFIER silent_mutation Average:81.864; most accessible tissue: Zhenshan97 flag leaf, score: 88.445 N N N N
vg0630366621 C -> A LOC_Os06g50154.1 upstream_gene_variant ; 4472.0bp to feature; MODIFIER silent_mutation Average:81.864; most accessible tissue: Zhenshan97 flag leaf, score: 88.445 N N N N
vg0630366621 C -> A LOC_Os06g50130.1 downstream_gene_variant ; 2811.0bp to feature; MODIFIER silent_mutation Average:81.864; most accessible tissue: Zhenshan97 flag leaf, score: 88.445 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0630366621 C A 0.04 0.02 0.02 0.0 0.02 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0630366621 NA 6.38E-06 mr1930 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 NA 3.27E-06 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 NA 3.87E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 NA 2.14E-06 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 NA 5.21E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 5.89E-06 5.88E-06 mr1286_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 3.09E-06 8.57E-07 mr1312_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 NA 8.29E-07 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 NA 7.55E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 NA 1.45E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 NA 3.88E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 6.41E-06 NA mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 4.20E-06 2.12E-07 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 5.05E-07 5.04E-07 mr1674_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 NA 2.21E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 4.62E-06 4.61E-06 mr1688_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 NA 6.19E-07 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 NA 2.78E-06 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 NA 4.86E-06 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 NA 9.82E-07 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 2.26E-06 2.25E-06 mr1847_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630366621 NA 6.11E-06 mr1923_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251