| Variant ID: vg0630268417 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 30268417 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTTCTCCATTTCAACCACACAATGGTACATATTGTTGGCAACTTTTTTGGCAAGTAGACAAACATAATCGCAACACCTAAACGCTTTGCGGTGATTGTAG[A/T]
GTCACAAATCACCCTAATCACTACCATATTTCACATGACAACAAATGATCCATTATCATTACAATAAATTTACGTCACGAAACATGAGCATATCTATTCA
TGAATAGATATGCTCATGTTTCGTGACGTAAATTTATTGTAATGATAATGGATCATTTGTTGTCATGTGAAATATGGTAGTGATTAGGGTGATTTGTGAC[T/A]
CTACAATCACCGCAAAGCGTTTAGGTGTTGCGATTATGTTTGTCTACTTGCCAAAAAAGTTGCCAACAATATGTACCATTGTGTGGTTGAAATGGAGAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.20% | 31.80% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 96.10% | 3.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 24.90% | 75.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 46.50% | 53.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.70% | 7.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 6.90% | 93.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 57.90% | 42.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 12.90% | 87.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 92.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0630268417 | A -> T | LOC_Os06g49970.2 | downstream_gene_variant ; 1502.0bp to feature; MODIFIER | silent_mutation | Average:46.589; most accessible tissue: Callus, score: 64.06 | N | N | N | N |
| vg0630268417 | A -> T | LOC_Os06g49980.1 | downstream_gene_variant ; 1502.0bp to feature; MODIFIER | silent_mutation | Average:46.589; most accessible tissue: Callus, score: 64.06 | N | N | N | N |
| vg0630268417 | A -> T | LOC_Os06g49970-LOC_Os06g49980 | intergenic_region ; MODIFIER | silent_mutation | Average:46.589; most accessible tissue: Callus, score: 64.06 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0630268417 | NA | 4.87E-19 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630268417 | NA | 1.63E-06 | mr1553_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630268417 | NA | 2.66E-08 | mr1623_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630268417 | NA | 2.21E-08 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630268417 | NA | 1.10E-07 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |