Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630108578:

Variant ID: vg0630108578 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 30108578
Reference Allele: A	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACGAGAGAGAGAGGTTGGGAAAAGTAGCATCCGAACACAGTTCTTTAGTACATGATATATGGGCTGTGTTTAGTTCCTGAAAAAAGTTGGAAGTTTGGG[A/G,T]
AAAGTTAAAAGTTTGGAAAAAAGTTAAAAGTTTATATGTGTAGGAAAGTTTTGAATGTGATGTGATATGATGGAAAGTTGGAAGTTTAGAGTAGTTGGGG

Reverse complement sequence

CCCCAACTACTCTAAACTTCCAACTTTCCATCATATCACATCACATTCAAAACTTTCCTACACATATAAACTTTTAACTTTTTTCCAAACTTTTAACTTT[T/C,A]
CCCAAACTTCCAACTTTTTTCAGGAACTAAACACAGCCCATATATCATGTACTAAAGAACTGTGTTCGGATGCTACTTTTCCCAACCTCTCTCTCTCGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.90%	17.20%	0.59%	0.34%	T: 0.04%
All Indica	2759	99.10%	0.50%	0.25%	0.11%	T: 0.07%
All Japonica	1512	45.60%	52.30%	1.26%	0.86%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.50%	0.50%	0.84%	0.17%	NA
Indica II	465	99.40%	0.00%	0.22%	0.00%	T: 0.43%
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.50%	1.10%	0.13%	0.25%	NA
Temperate Japonica	767	7.40%	92.20%	0.39%	0.00%	NA
Tropical Japonica	504	93.30%	1.80%	2.98%	1.98%	NA
Japonica Intermediate	241	67.20%	31.10%	0.41%	1.24%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	6.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0630108578	A -> G	LOC_Os06g49760.1	upstream_gene_variant ; 1745.0bp to feature; MODIFIER	silent_mutation	Average:45.527; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0630108578	A -> G	LOC_Os06g49760-LOC_Os06g49770	intergenic_region ; MODIFIER	silent_mutation	Average:45.527; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0630108578	A -> T	LOC_Os06g49760.1	upstream_gene_variant ; 1745.0bp to feature; MODIFIER	silent_mutation	Average:45.527; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0630108578	A -> T	LOC_Os06g49760-LOC_Os06g49770	intergenic_region ; MODIFIER	silent_mutation	Average:45.527; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0630108578	A -> DEL	N	N	silent_mutation	Average:45.527; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0630108578	NA	9.65E-08	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630108578	2.23E-06	2.41E-06	mr1923	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630108578	NA	1.01E-06	mr1064_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630108578	NA	4.27E-06	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630108578	NA	3.38E-08	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630108578	NA	5.00E-06	mr1923_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630108578	NA	8.53E-06	mr1923_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251