\
| Variant ID: vg0630108578 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 30108578 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AACGAGAGAGAGAGGTTGGGAAAAGTAGCATCCGAACACAGTTCTTTAGTACATGATATATGGGCTGTGTTTAGTTCCTGAAAAAAGTTGGAAGTTTGGG[A/G,T]
AAAGTTAAAAGTTTGGAAAAAAGTTAAAAGTTTATATGTGTAGGAAAGTTTTGAATGTGATGTGATATGATGGAAAGTTGGAAGTTTAGAGTAGTTGGGG
CCCCAACTACTCTAAACTTCCAACTTTCCATCATATCACATCACATTCAAAACTTTCCTACACATATAAACTTTTAACTTTTTTCCAAACTTTTAACTTT[T/C,A]
CCCAAACTTCCAACTTTTTTCAGGAACTAAACACAGCCCATATATCATGTACTAAAGAACTGTGTTCGGATGCTACTTTTCCCAACCTCTCTCTCTCGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.90% | 17.20% | 0.59% | 0.34% | T: 0.04% |
| All Indica | 2759 | 99.10% | 0.50% | 0.25% | 0.11% | T: 0.07% |
| All Japonica | 1512 | 45.60% | 52.30% | 1.26% | 0.86% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 0.50% | 0.84% | 0.17% | NA |
| Indica II | 465 | 99.40% | 0.00% | 0.22% | 0.00% | T: 0.43% |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.10% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 7.40% | 92.20% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 93.30% | 1.80% | 2.98% | 1.98% | NA |
| Japonica Intermediate | 241 | 67.20% | 31.10% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0630108578 | A -> G | LOC_Os06g49760.1 | upstream_gene_variant ; 1745.0bp to feature; MODIFIER | silent_mutation | Average:45.527; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0630108578 | A -> G | LOC_Os06g49760-LOC_Os06g49770 | intergenic_region ; MODIFIER | silent_mutation | Average:45.527; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0630108578 | A -> T | LOC_Os06g49760.1 | upstream_gene_variant ; 1745.0bp to feature; MODIFIER | silent_mutation | Average:45.527; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0630108578 | A -> T | LOC_Os06g49760-LOC_Os06g49770 | intergenic_region ; MODIFIER | silent_mutation | Average:45.527; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0630108578 | A -> DEL | N | N | silent_mutation | Average:45.527; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0630108578 | NA | 9.65E-08 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630108578 | 2.23E-06 | 2.41E-06 | mr1923 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630108578 | NA | 1.01E-06 | mr1064_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630108578 | NA | 4.27E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630108578 | NA | 3.38E-08 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630108578 | NA | 5.00E-06 | mr1923_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630108578 | NA | 8.53E-06 | mr1923_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |