\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630078359:

Variant ID: vg0630078359 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 30078359
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


GCTATAGCAAGTTTTGCCAAATTCATGGTCCAGGAGGCCATTCCACTCAGGAATGTAGGCACATGGCCTACTTAGTGGAAAAGCATGTCAGTCGATATGA[G/A]
AACAAGTATGAGGGGGCCCGAGATCAGCGAGGGCAAAATGCTATAGAAGCACCACAAGTCATAAAAATCTAGAAGCAATCGAAGAAGCTCCAAAAAGGGT

Reverse complement sequence

ACCCTTTTTGGAGCTTCTTCGATTGCTTCTAGATTTTTATGACTTGTGGTGCTTCTATAGCATTTTGCCCTCGCTGATCTCGGGCCCCCTCATACTTGTT[C/T]
TCATATCGACTGACATGCTTTTCCACTAAGTAGGCCATGTGCCTACATTCCTGAGTGGAATGGCCTCCTGGACCATGAATTTGGCAAAACTTGCTATAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.80% 7.60% 1.74% 38.83% NA
All Indica  2759 53.60% 8.10% 1.78% 36.53% NA
All Japonica  1512 58.50% 1.40% 0.93% 39.15% NA
Aus  269 9.30% 40.90% 5.20% 44.61% NA
Indica I  595 37.00% 8.40% 2.35% 52.27% NA
Indica II  465 78.90% 1.50% 0.43% 19.14% NA
Indica III  913 54.40% 9.10% 1.64% 34.83% NA
Indica Intermediate  786 50.10% 10.70% 2.29% 36.90% NA
Temperate Japonica  767 94.10% 0.00% 0.39% 5.48% NA
Tropical Japonica  504 13.50% 3.60% 1.39% 81.55% NA
Japonica Intermediate  241 39.40% 1.20% 1.66% 57.68% NA
VI/Aromatic  96 10.40% 2.10% 4.17% 83.33% NA
Intermediate  90 55.60% 4.40% 1.11% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0630078359 G -> A LOC_Os06g49720.1 upstream_gene_variant ; 699.0bp to feature; MODIFIER silent_mutation Average:21.499; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0630078359 G -> A LOC_Os06g49700.1 downstream_gene_variant ; 4603.0bp to feature; MODIFIER silent_mutation Average:21.499; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0630078359 G -> A LOC_Os06g49710.1 downstream_gene_variant ; 2860.0bp to feature; MODIFIER silent_mutation Average:21.499; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0630078359 G -> A LOC_Os06g49710-LOC_Os06g49720 intergenic_region ; MODIFIER silent_mutation Average:21.499; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0630078359 G -> DEL N N silent_mutation Average:21.499; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0630078359 NA 1.51E-08 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 7.34E-07 mr1049 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 8.32E-07 mr1049 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 6.05E-07 6.05E-07 mr1058 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 1.48E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 1.48E-08 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 4.53E-08 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 1.64E-08 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 3.02E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 8.44E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 5.53E-06 mr1289 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 4.98E-06 4.98E-06 mr1345 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 4.81E-06 6.29E-07 mr1367 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 2.98E-06 2.98E-06 mr1367 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 2.05E-07 2.04E-07 mr1370 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 1.25E-06 1.25E-06 mr1370 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 8.42E-06 mr1371 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 5.17E-07 1.36E-08 mr1375 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 1.99E-07 1.99E-07 mr1398 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 6.02E-07 mr1401 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 5.55E-06 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 5.87E-06 5.87E-06 mr1463 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 6.36E-06 mr1574 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 5.79E-07 mr1603 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 3.59E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 2.27E-08 3.61E-09 mr1606 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 1.16E-06 mr1669 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 4.54E-06 4.54E-06 mr1674 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 5.93E-06 mr1731 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 1.70E-06 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 6.65E-07 mr1788 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 6.83E-07 mr1788 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 7.49E-06 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 8.87E-06 8.87E-06 mr1876 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 1.25E-07 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 NA 8.62E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 3.85E-06 3.85E-06 mr1953 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 1.86E-07 1.86E-07 mr1953 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 3.18E-07 9.22E-09 mr1981 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630078359 4.22E-06 2.17E-08 mr1981 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251