\
| Variant ID: vg0630043980 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 30043980 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.11, others allele: 0.00, population size: 99. )
ATGAATCACCAGTGTAACACCCTGAAAATTCGACCAACGAAATCAAAACACCAAAAATATTGCATCATGCCGATTTTATTCGCCTATTTCATTAGATTTT[A/G]
ATCTCGGAATTTATTAATCGCGAATAATGAATAACTAACTAGGAATAAACCCTAAAAATCAAGTTGGCTAAATAAATAATTAAAATATAAATTAAAATAA
TTATTTTAATTTATATTTTAATTATTTATTTAGCCAACTTGATTTTTAGGGTTTATTCCTAGTTAGTTATTCATTATTCGCGATTAATAAATTCCGAGAT[T/C]
AAAATCTAATGAAATAGGCGAATAAAATCGGCATGATGCAATATTTTTGGTGTTTTGATTTCGTTGGTCGAATTTTCAGGGTGTTACACTGGTGATTCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.60% | 16.40% | 12.61% | 2.45% | NA |
| All Indica | 2759 | 93.80% | 0.40% | 2.65% | 3.19% | NA |
| All Japonica | 1512 | 19.30% | 50.00% | 29.10% | 1.59% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.60% | 0.30% | 1.01% | 9.08% | NA |
| Indica II | 465 | 99.10% | 0.20% | 0.65% | 0.00% | NA |
| Indica III | 913 | 95.10% | 0.10% | 4.38% | 0.44% | NA |
| Indica Intermediate | 786 | 92.20% | 0.90% | 3.05% | 3.82% | NA |
| Temperate Japonica | 767 | 6.30% | 90.00% | 3.65% | 0.13% | NA |
| Tropical Japonica | 504 | 39.50% | 2.20% | 55.95% | 2.38% | NA |
| Japonica Intermediate | 241 | 18.70% | 22.80% | 53.94% | 4.56% | NA |
| VI/Aromatic | 96 | 24.00% | 0.00% | 73.96% | 2.08% | NA |
| Intermediate | 90 | 76.70% | 7.80% | 13.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0630043980 | A -> G | LOC_Os06g49650.1 | upstream_gene_variant ; 4404.0bp to feature; MODIFIER | silent_mutation | Average:20.181; most accessible tissue: Callus, score: 44.454 | N | N | N | N |
| vg0630043980 | A -> G | LOC_Os06g49650-LOC_Os06g49660 | intergenic_region ; MODIFIER | silent_mutation | Average:20.181; most accessible tissue: Callus, score: 44.454 | N | N | N | N |
| vg0630043980 | A -> DEL | N | N | silent_mutation | Average:20.181; most accessible tissue: Callus, score: 44.454 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0630043980 | NA | 1.59E-67 | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630043980 | NA | 5.19E-08 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630043980 | NA | 3.16E-07 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630043980 | NA | 1.59E-08 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630043980 | NA | 5.15E-14 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630043980 | NA | 9.62E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630043980 | NA | 8.76E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630043980 | 2.76E-08 | NA | mr1871 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630043980 | NA | 1.43E-08 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630043980 | NA | 6.44E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630043980 | NA | 1.77E-07 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630043980 | NA | 5.70E-11 | mr1368_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630043980 | NA | 1.01E-09 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630043980 | NA | 6.75E-07 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630043980 | NA | 1.60E-09 | mr1584_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630043980 | NA | 4.37E-09 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |