\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0629926258:

Variant ID: vg0629926258 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 29926258
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, T: 0.32, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


GTCACTATCGGCTTCAGAGTCTTGGAATCGGCCGATGGGAGTTGTCAAGTCGCCAGCAATTGTGTTCTATATGAAGTCGGATCAATTAAAGAAAATTTAT[C/T]
CAAAAGAGTCCGAGTTCAAGGAGGATGCGGCATGACAAGTATATCTATTAATTAAGAATAGTATGTTAGTTTTCTTTTATCTCTAGAAAAGTGTGTTTAT

Reverse complement sequence

ATAAACACACTTTTCTAGAGATAAAAGAAAACTAACATACTATTCTTAATTAATAGATATACTTGTCATGCCGCATCCTCCTTGAACTCGGACTCTTTTG[G/A]
ATAAATTTTCTTTAATTGATCCGACTTCATATAGAACACAATTGCTGGCGACTTGACAACTCCCATCGGCCGATTCCAAGACTCTGAAGCCGATAGTGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.00% 16.50% 1.33% 55.12% NA
All Indica  2759 17.90% 0.50% 0.62% 80.94% NA
All Japonica  1512 43.80% 49.90% 2.38% 3.90% NA
Aus  269 1.10% 1.50% 1.86% 95.54% NA
Indica I  595 11.80% 0.70% 0.17% 87.39% NA
Indica II  465 35.50% 0.20% 0.65% 63.66% NA
Indica III  913 11.00% 0.20% 0.33% 88.50% NA
Indica Intermediate  786 20.40% 0.90% 1.27% 77.48% NA
Temperate Japonica  767 4.30% 90.00% 2.09% 3.65% NA
Tropical Japonica  504 93.30% 1.60% 0.60% 4.56% NA
Japonica Intermediate  241 66.40% 23.20% 7.05% 3.32% NA
VI/Aromatic  96 86.50% 0.00% 1.04% 12.50% NA
Intermediate  90 35.60% 11.10% 4.44% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0629926258 C -> T LOC_Os06g49380.1 upstream_gene_variant ; 1718.0bp to feature; MODIFIER silent_mutation Average:10.513; most accessible tissue: Callus, score: 60.944 N N N N
vg0629926258 C -> T LOC_Os06g49380.2 upstream_gene_variant ; 1718.0bp to feature; MODIFIER silent_mutation Average:10.513; most accessible tissue: Callus, score: 60.944 N N N N
vg0629926258 C -> T LOC_Os06g49380.3 upstream_gene_variant ; 1718.0bp to feature; MODIFIER silent_mutation Average:10.513; most accessible tissue: Callus, score: 60.944 N N N N
vg0629926258 C -> T LOC_Os06g49380.4 upstream_gene_variant ; 1718.0bp to feature; MODIFIER silent_mutation Average:10.513; most accessible tissue: Callus, score: 60.944 N N N N
vg0629926258 C -> T LOC_Os06g49380.5 upstream_gene_variant ; 1718.0bp to feature; MODIFIER silent_mutation Average:10.513; most accessible tissue: Callus, score: 60.944 N N N N
vg0629926258 C -> T LOC_Os06g49380.6 upstream_gene_variant ; 1718.0bp to feature; MODIFIER silent_mutation Average:10.513; most accessible tissue: Callus, score: 60.944 N N N N
vg0629926258 C -> T LOC_Os06g49390.1 downstream_gene_variant ; 512.0bp to feature; MODIFIER silent_mutation Average:10.513; most accessible tissue: Callus, score: 60.944 N N N N
vg0629926258 C -> T LOC_Os06g49380-LOC_Os06g49390 intergenic_region ; MODIFIER silent_mutation Average:10.513; most accessible tissue: Callus, score: 60.944 N N N N
vg0629926258 C -> DEL N N silent_mutation Average:10.513; most accessible tissue: Callus, score: 60.944 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0629926258 NA 5.16E-10 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 4.12E-37 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 5.88E-21 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 5.39E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 5.97E-16 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 8.49E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 5.02E-31 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 2.50E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 9.70E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 1.38E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 1.27E-20 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 5.52E-41 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 1.80E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 6.31E-23 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 1.01E-07 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 8.75E-13 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258 NA 5.80E-22 mr1980_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251