\
| Variant ID: vg0629926258 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 29926258 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, T: 0.32, others allele: 0.00, population size: 72. )
GTCACTATCGGCTTCAGAGTCTTGGAATCGGCCGATGGGAGTTGTCAAGTCGCCAGCAATTGTGTTCTATATGAAGTCGGATCAATTAAAGAAAATTTAT[C/T]
CAAAAGAGTCCGAGTTCAAGGAGGATGCGGCATGACAAGTATATCTATTAATTAAGAATAGTATGTTAGTTTTCTTTTATCTCTAGAAAAGTGTGTTTAT
ATAAACACACTTTTCTAGAGATAAAAGAAAACTAACATACTATTCTTAATTAATAGATATACTTGTCATGCCGCATCCTCCTTGAACTCGGACTCTTTTG[G/A]
ATAAATTTTCTTTAATTGATCCGACTTCATATAGAACACAATTGCTGGCGACTTGACAACTCCCATCGGCCGATTCCAAGACTCTGAAGCCGATAGTGAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.00% | 16.50% | 1.33% | 55.12% | NA |
| All Indica | 2759 | 17.90% | 0.50% | 0.62% | 80.94% | NA |
| All Japonica | 1512 | 43.80% | 49.90% | 2.38% | 3.90% | NA |
| Aus | 269 | 1.10% | 1.50% | 1.86% | 95.54% | NA |
| Indica I | 595 | 11.80% | 0.70% | 0.17% | 87.39% | NA |
| Indica II | 465 | 35.50% | 0.20% | 0.65% | 63.66% | NA |
| Indica III | 913 | 11.00% | 0.20% | 0.33% | 88.50% | NA |
| Indica Intermediate | 786 | 20.40% | 0.90% | 1.27% | 77.48% | NA |
| Temperate Japonica | 767 | 4.30% | 90.00% | 2.09% | 3.65% | NA |
| Tropical Japonica | 504 | 93.30% | 1.60% | 0.60% | 4.56% | NA |
| Japonica Intermediate | 241 | 66.40% | 23.20% | 7.05% | 3.32% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 1.04% | 12.50% | NA |
| Intermediate | 90 | 35.60% | 11.10% | 4.44% | 48.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0629926258 | C -> T | LOC_Os06g49380.1 | upstream_gene_variant ; 1718.0bp to feature; MODIFIER | silent_mutation | Average:10.513; most accessible tissue: Callus, score: 60.944 | N | N | N | N |
| vg0629926258 | C -> T | LOC_Os06g49380.2 | upstream_gene_variant ; 1718.0bp to feature; MODIFIER | silent_mutation | Average:10.513; most accessible tissue: Callus, score: 60.944 | N | N | N | N |
| vg0629926258 | C -> T | LOC_Os06g49380.3 | upstream_gene_variant ; 1718.0bp to feature; MODIFIER | silent_mutation | Average:10.513; most accessible tissue: Callus, score: 60.944 | N | N | N | N |
| vg0629926258 | C -> T | LOC_Os06g49380.4 | upstream_gene_variant ; 1718.0bp to feature; MODIFIER | silent_mutation | Average:10.513; most accessible tissue: Callus, score: 60.944 | N | N | N | N |
| vg0629926258 | C -> T | LOC_Os06g49380.5 | upstream_gene_variant ; 1718.0bp to feature; MODIFIER | silent_mutation | Average:10.513; most accessible tissue: Callus, score: 60.944 | N | N | N | N |
| vg0629926258 | C -> T | LOC_Os06g49380.6 | upstream_gene_variant ; 1718.0bp to feature; MODIFIER | silent_mutation | Average:10.513; most accessible tissue: Callus, score: 60.944 | N | N | N | N |
| vg0629926258 | C -> T | LOC_Os06g49390.1 | downstream_gene_variant ; 512.0bp to feature; MODIFIER | silent_mutation | Average:10.513; most accessible tissue: Callus, score: 60.944 | N | N | N | N |
| vg0629926258 | C -> T | LOC_Os06g49380-LOC_Os06g49390 | intergenic_region ; MODIFIER | silent_mutation | Average:10.513; most accessible tissue: Callus, score: 60.944 | N | N | N | N |
| vg0629926258 | C -> DEL | N | N | silent_mutation | Average:10.513; most accessible tissue: Callus, score: 60.944 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0629926258 | NA | 5.16E-10 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 4.12E-37 | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 5.88E-21 | mr1584 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 5.39E-09 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 5.97E-16 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 8.49E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 5.02E-31 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 2.50E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 9.70E-18 | mr1156_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 1.38E-07 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 1.27E-20 | mr1361_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 5.52E-41 | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 1.80E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 6.31E-23 | mr1593_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 1.01E-07 | mr1606_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 8.75E-13 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0629926258 | NA | 5.80E-22 | mr1980_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |