Variant ID: vg0629827585 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 29827585 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCTCAAATAACCCAATTCGCTCATATGAAGATTTGAACTCAGGACTTTGGGTGCTACTCAGGTCACTGCAACCAATAGGCTACATGCCCTTTCACAAAT[A/G]
GAGCGGCGCATGCTGTAGCCGTCCTGCAAGCAGTGCAAAAGCTCCCAAAGAGTGTCCACATGTCCCAATGACACCGTGCGCAGCGTCACCCTCCCCAACC
GGTTGGGGAGGGTGACGCTGCGCACGGTGTCATTGGGACATGTGGACACTCTTTGGGAGCTTTTGCACTGCTTGCAGGACGGCTACAGCATGCGCCGCTC[T/C]
ATTTGTGAAAGGGCATGTAGCCTATTGGTTGCAGTGACCTGAGTAGCACCCAAAGTCCTGAGTTCAAATCTTCATATGAGCGAATTGGGTTATTTGAGAG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.40% | 3.30% | 4.30% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 76.50% | 10.20% | 13.36% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 54.60% | 19.80% | 25.55% | 0.00% | NA |
Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
Japonica Intermediate | 241 | 97.50% | 0.80% | 1.66% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0629827585 | A -> G | LOC_Os06g49230.1 | upstream_gene_variant ; 885.0bp to feature; MODIFIER | silent_mutation | Average:62.283; most accessible tissue: Minghui63 root, score: 82.511 | N | N | N | N |
vg0629827585 | A -> G | LOC_Os06g49240.1 | upstream_gene_variant ; 1890.0bp to feature; MODIFIER | silent_mutation | Average:62.283; most accessible tissue: Minghui63 root, score: 82.511 | N | N | N | N |
vg0629827585 | A -> G | LOC_Os06g49220.1 | downstream_gene_variant ; 799.0bp to feature; MODIFIER | silent_mutation | Average:62.283; most accessible tissue: Minghui63 root, score: 82.511 | N | N | N | N |
vg0629827585 | A -> G | LOC_Os06g49220-LOC_Os06g49230 | intergenic_region ; MODIFIER | silent_mutation | Average:62.283; most accessible tissue: Minghui63 root, score: 82.511 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0629827585 | NA | 3.40E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0629827585 | NA | 2.85E-09 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0629827585 | NA | 7.02E-06 | mr1051_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0629827585 | NA | 3.59E-10 | mr1627_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0629827585 | 4.64E-06 | 2.09E-06 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |