\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0629827585:

Variant ID: vg0629827585 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 29827585
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTCAAATAACCCAATTCGCTCATATGAAGATTTGAACTCAGGACTTTGGGTGCTACTCAGGTCACTGCAACCAATAGGCTACATGCCCTTTCACAAAT[A/G]
GAGCGGCGCATGCTGTAGCCGTCCTGCAAGCAGTGCAAAAGCTCCCAAAGAGTGTCCACATGTCCCAATGACACCGTGCGCAGCGTCACCCTCCCCAACC

Reverse complement sequence

GGTTGGGGAGGGTGACGCTGCGCACGGTGTCATTGGGACATGTGGACACTCTTTGGGAGCTTTTGCACTGCTTGCAGGACGGCTACAGCATGCGCCGCTC[T/C]
ATTTGTGAAAGGGCATGTAGCCTATTGGTTGCAGTGACCTGAGTAGCACCCAAAGTCCTGAGTTCAAATCTTCATATGAGCGAATTGGGTTATTTGAGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 3.30% 4.30% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 76.50% 10.20% 13.36% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 54.60% 19.80% 25.55% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.40% 0.00% NA
Japonica Intermediate  241 97.50% 0.80% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0629827585 A -> G LOC_Os06g49230.1 upstream_gene_variant ; 885.0bp to feature; MODIFIER silent_mutation Average:62.283; most accessible tissue: Minghui63 root, score: 82.511 N N N N
vg0629827585 A -> G LOC_Os06g49240.1 upstream_gene_variant ; 1890.0bp to feature; MODIFIER silent_mutation Average:62.283; most accessible tissue: Minghui63 root, score: 82.511 N N N N
vg0629827585 A -> G LOC_Os06g49220.1 downstream_gene_variant ; 799.0bp to feature; MODIFIER silent_mutation Average:62.283; most accessible tissue: Minghui63 root, score: 82.511 N N N N
vg0629827585 A -> G LOC_Os06g49220-LOC_Os06g49230 intergenic_region ; MODIFIER silent_mutation Average:62.283; most accessible tissue: Minghui63 root, score: 82.511 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0629827585 NA 3.40E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629827585 NA 2.85E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629827585 NA 7.02E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629827585 NA 3.59E-10 mr1627_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629827585 4.64E-06 2.09E-06 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251