Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0629694174:

Variant ID: vg0629694174 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 29694174
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAGAGTAATACTACTAGGGCTGTGTTTAGTTGGATCCAAAGTTTGTATTTTGGTTGAGATTAGAGATGATGTGACTGAAAAATTATGTGTGTATGACAG[A/G]
TTGATGTGATGGAAAAGGACTGAAGTTTGGATCCAAACTTTAGATCAAAACACAGCCTAGTACTAGTACAACAGAATGAGTATATCACATGAATTAGTTG

Reverse complement sequence

CAACTAATTCATGTGATATACTCATTCTGTTGTACTAGTACTAGGCTGTGTTTTGATCTAAAGTTTGGATCCAAACTTCAGTCCTTTTCCATCACATCAA[T/C]
CTGTCATACACACATAATTTTTCAGTCACATCATCTCTAATCTCAACCAAAATACAAACTTTGGATCCAACTAAACACAGCCCTAGTAGTATTACTCTGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	3.40%	0.17%	3.36%	NA
All Indica	2759	99.60%	0.30%	0.04%	0.07%	NA
All Japonica	1512	79.80%	9.60%	0.46%	10.12%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.00%	0.22%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	0.90%	0.13%	0.13%	NA
Temperate Japonica	767	81.10%	18.00%	0.26%	0.65%	NA
Tropical Japonica	504	71.20%	0.00%	0.60%	28.17%	NA
Japonica Intermediate	241	93.80%	2.90%	0.83%	2.49%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	2.20%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0629694174	A -> G	LOC_Os06g48990.1	upstream_gene_variant ; 4063.0bp to feature; MODIFIER	silent_mutation	Average:60.223; most accessible tissue: Zhenshan97 flower, score: 81.855	N	N	N	N
vg0629694174	A -> G	LOC_Os06g49000.1	upstream_gene_variant ; 2406.0bp to feature; MODIFIER	silent_mutation	Average:60.223; most accessible tissue: Zhenshan97 flower, score: 81.855	N	N	N	N
vg0629694174	A -> G	LOC_Os06g48990.2	upstream_gene_variant ; 4063.0bp to feature; MODIFIER	silent_mutation	Average:60.223; most accessible tissue: Zhenshan97 flower, score: 81.855	N	N	N	N
vg0629694174	A -> G	LOC_Os06g49000.2	upstream_gene_variant ; 2386.0bp to feature; MODIFIER	silent_mutation	Average:60.223; most accessible tissue: Zhenshan97 flower, score: 81.855	N	N	N	N
vg0629694174	A -> G	LOC_Os06g48990-LOC_Os06g49000	intergenic_region ; MODIFIER	silent_mutation	Average:60.223; most accessible tissue: Zhenshan97 flower, score: 81.855	N	N	N	N
vg0629694174	A -> DEL	N	N	silent_mutation	Average:60.223; most accessible tissue: Zhenshan97 flower, score: 81.855	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0629694174	NA	4.89E-06	mr1028	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	7.85E-06	7.85E-06	mr1369	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	NA	5.03E-09	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	NA	5.39E-06	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	NA	2.51E-06	mr1697	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	NA	6.74E-06	mr1921	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	NA	6.45E-06	mr1030_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	NA	1.91E-08	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	NA	1.08E-06	mr1296_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	NA	1.60E-06	mr1358_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	NA	2.12E-06	mr1561_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	8.76E-06	8.76E-06	mr1571_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	NA	3.19E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	NA	1.56E-07	mr1875_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	4.06E-06	4.06E-06	mr1908_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	NA	4.56E-06	mr1994_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629694174	NA	2.22E-06	mr1996_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251